
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dennd4a
- Ensembl ID:
- ENSDARG00000062721
- ZFIN ID:
- ZDB-GENE-060503-285
- Description:
- C-myc promoter-binding protein [Source:RefSeq peptide;Acc:NP_001074458]
- Human Orthologue:
- DENND4A
- Human Description:
- DENN/MADD domain containing 4A [Source:HGNC Symbol;Acc:24321]
- Mouse Orthologue:
- Dennd4a
- Mouse Description:
- DENN/MADD domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:2142979]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43085 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43084 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12574 | Nonsense | Available for shipment | Available now |
sa43083 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36626 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43085
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090922 | Nonsense | 513 | 1714 | 10 | 29 |
ENSDART00000090962 | Nonsense | 513 | 1674 | 10 | 28 |
ENSDART00000129591 | Nonsense | 513 | 1724 | 10 | 30 |
- Genomic Location (Zv9):
- Chromosome 18 (position 18866289)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 19096512 GRCz11 18 19085578 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGAAGAGCGCAGATCCCTGACCTGGAAGATCCTGCCAAGAAAAGCCTGT[A/T]AACATCTGATCAACACCCTCAGCAATCTCCACCAGCAACTGGATGAGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43084
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090922 | Nonsense | 811 | 1714 | 16 | 29 |
ENSDART00000090962 | Nonsense | 811 | 1674 | 16 | 28 |
ENSDART00000129591 | Nonsense | 820 | 1724 | 17 | 30 |
- Genomic Location (Zv9):
- Chromosome 18 (position 18852569)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 19082792 GRCz11 18 19071858 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTTGTGATTTTGTGTTTAACGGTTTGTTTCTGGCCCTCTGGAGGTGTG[T/A]TATCGAGTGCTGATGCAGCTGTGTGGGCAATACGGTCAACCTGTTCTAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12574
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090922 | Nonsense | 885 | 1714 | 17 | 29 |
ENSDART00000090962 | Nonsense | 885 | 1674 | 17 | 28 |
ENSDART00000129591 | Nonsense | 894 | 1724 | 18 | 30 |
- Genomic Location (Zv9):
- Chromosome 18 (position 18849414)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 19079637 GRCz11 18 19068703 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCTGTGGGGAAAGCTGAGAAATGTKGTCCGGGGTGTGGTGCTGTTCAAA[C/T]AAGTATGGAGGAGGCAGACCACCCACCCSAAAKACACTCATCTTTCTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43083
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090922 | Nonsense | 890 | 1714 | 17 | 29 |
ENSDART00000090962 | Nonsense | 890 | 1674 | 17 | 28 |
ENSDART00000129591 | Nonsense | 899 | 1724 | 18 | 30 |
- Genomic Location (Zv9):
- Chromosome 18 (position 18849399)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 19079622 GRCz11 18 19068688 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGAAATGTGGTCCGGGGTGTGGTGCTGTTCAAACAAGTATGGAGGAGG[C/T]AGACCACCCACCCGAAAGACACTCATCTTTCTGGTAAAACCCCCAACTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36626
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090922 | Nonsense | 963 | 1714 | 19 | 29 |
ENSDART00000090962 | Nonsense | 922 | 1674 | 18 | 28 |
ENSDART00000129591 | Nonsense | 972 | 1724 | 20 | 30 |
- Genomic Location (Zv9):
- Chromosome 18 (position 18841887)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 19072110 GRCz11 18 19061176 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAGGGCTACGACTCTCTGTCTAAAGAGGAGGTGAGGTTTGGTGGAGGT[G/T]AAGAGCAGAACTCCTCTCCAGACATCAAGGAGAAGAAGGACAGAGACTCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Red blood cell traits: Seventy-five genetic loci influencing the human red blood cell. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: