si:dkey-236e20.7

Ensembl ID:
ENSDARG00000062712
ZFIN ID:
ZDB-GENE-060503-911
Description:
hypothetical protein LOC798655 [Source:RefSeq peptide;Acc:NP_001076396]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37471 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090975 Nonsense 80 328 1 1
Genomic Location (Zv9):
Chromosome 22 (position 15530811)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15358820
GRCz11 22 15385203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGTGCTGAGGTTCGAACTGCTAAACGTGGCTACGCTATGATTCTCTG[G/A]TTCTTCTACGTCTTTGTGCTTGAGATAAAGGTCTACTTCGTCTATCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link