si:rp71-69p9.2

Ensembl ID:
ENSDARG00000062702
ZFIN ID:
ZDB-GENE-050208-740
Description:
Novel protein similar to human ankyrin repeat and MYND domain containing 1 (ANKMY1) [Source:UniProtK
Human Orthologue:
ANKMY1
Human Description:
ankyrin repeat and MYND domain containing 1 [Source:HGNC Symbol;Acc:20987]
Mouse Orthologue:
Ankmy1
Mouse Description:
ankyrin repeat and MYND domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3045261]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29745 Nonsense Mutation detected in F1 DNA Unknown
sa11746 Nonsense Available for shipment Available now
sa24118 Nonsense Available for shipment Available now
sa24117 Essential Splice Site Available for shipment Available now
sa14629 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090936 Nonsense 70 994 2 16
ENSDART00000132334 Nonsense 70 360 2 5
ENSDART00000141528   None 445 None 10
Genomic Location (Zv9):
Chromosome 22 (position 15713324)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15541333
GRCz11 22 15567716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGTCACGGCAAAGGCACATACTCCTGGCCGGATGGATCTAAATACACA[G/T]GAAAGTTTTATCTGAATCGAAAAGAGGGATACGGAGTGCAAGTTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090936 Nonsense 707 994 10 16
ENSDART00000132334   None 360 None 5
ENSDART00000141528 Nonsense 158 445 4 10
Genomic Location (Zv9):
Chromosome 22 (position 15705982)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15533991
GRCz11 22 15560374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTAGAGATGTGGTGGCGCTTCTCCTTTCTCACTGTGCGAGCCCCAAT[G/T]AAGTCTGGAGTGGYCATTCACCTTTGTCTCTGGCCATCGCCAGTGGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090936 Nonsense 715 994 10 16
ENSDART00000132334   None 360 None 5
ENSDART00000141528 Nonsense 166 445 4 10
Genomic Location (Zv9):
Chromosome 22 (position 15705957)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15533966
GRCz11 22 15560349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCTCACTGTGCGAGCCCCAATGAAGTCTGGAGTGGCCATTCACCTT[T/A]GTCTCTGGCCATCGCCAGTGGCAACCACCTTGTATGTGGTATTTTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090936 Essential Splice Site 770 994 12 16
ENSDART00000132334   None 360 None 5
ENSDART00000141528 Essential Splice Site 221 445 6 10
Genomic Location (Zv9):
Chromosome 22 (position 15703401)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15531410
GRCz11 22 15557793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAATAAAGTTCTCATCTCTCTTTGTGTGTGTGTGTGTCTCAATCCA[G/A]CTGGATAAGCTAGTGAAAGCAGGCGCTGACGTTCTCATGCCTGTGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090936 Essential Splice Site 807 994 12 16
ENSDART00000132334   None 360 None 5
ENSDART00000141528 Essential Splice Site 258 445 6 10
Genomic Location (Zv9):
Chromosome 22 (position 15703285)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15531294
GRCz11 22 15557677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTACGATGGGAACAGTAGTGGATTATGCACACAKCACATTCCAACAGG[T/C]GCAGCTTTTCATCGCCACTTCATTTTAAAGAGCTTCATTTATCGCCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link