si:dkey-4c23.7

Ensembl ID:
ENSDARG00000062633
ZFIN IDs:
ZDB-GENE-050208-510, ZDB-GENE-080506-3
Description:
cell adhesion molecule 2b [Source:RefSeq peptide;Acc:NP_001107027]
Human Orthologue:
CADM2
Human Description:
cell adhesion molecule 2 [Source:HGNC Symbol;Acc:29849]
Mouse Orthologue:
Cadm2
Mouse Description:
cell adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:2442722]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22591 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090790 Essential Splice Site 214 383 5 9
ENSDART00000139504   None 50 None 1
Genomic Location (Zv9):
Chromosome 15 (position 8178439)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8127946
GRCz11 15 8104017
KASP Assay ID:
2260-8160.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTGGGCTCTTTACCGCACCAGGTCACAGAAGTGCTGGAGGTTCACTG[T/C]GAGTCACGCTTTTGGACTTTTGTTTGACAGAAAAAAGCTTTGAGATTAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link