zgc:153218

Ensembl ID:
ENSDARG00000062614
ZFIN ID:
ZDB-GENE-060929-596
Description:
probable asparaginyl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_001070623]
Human Orthologue:
NARS2
Human Description:
asparaginyl-tRNA synthetase 2, mitochondrial (putative) [Source:HGNC Symbol;Acc:26274]
Mouse Orthologue:
Nars2
Mouse Description:
asparaginyl-tRNA synthetase 2 (mitochondrial)(putative) Gene [Source:MGI Symbol;Acc:MGI:2142075]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35877 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090739 Essential Splice Site 315 485 8 14
ENSDART00000139152 Essential Splice Site 108 145 4 9
Genomic Location (Zv9):
Chromosome 15 (position 21650309)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9637601
GRCz11 15 9613672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGAGGATGTGGAGTTATTTCACAAACATGTGGCACCAGGACATCGG[G/T]TATGATGAGCAAAGCTTTTATTAGAGCATTGAGTGTTTGTGCAAAACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link