si:dkey-26i13.8

Ensembl ID:
ENSDARG00000062606
ZFIN ID:
ZDB-GENE-090312-134

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18615 Nonsense Available for shipment Available now
sa39563 Nonsense Mutation detected in F1 DNA During 2018
sa15225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090721 Nonsense 417 991 12 21
ENSDART00000138355   None 126 None 6
ENSDART00000147623 Nonsense 417 911 13 22
Genomic Location (Zv9):
Chromosome 1 (position 10905550)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11037627
GRCz11 1 11724427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGCTGTTWCAGCTGAAGTGCAACAGTACAGTCATGGTGAGATGGCTT[T/A]ACTGCAGGAGCAGCTCCTGTCTGCCTTCAGGGAGCAGATGGAGATCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090721 Nonsense 929 991 20 21
ENSDART00000138355   None 126 None 6
ENSDART00000147623 Nonsense 849 911 21 22
Genomic Location (Zv9):
Chromosome 1 (position 10913915)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11045992
GRCz11 1 11732792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGGGAACACCACCCAGCACCATCCATCAAAAACACTCAGACACCAAA[C/T]GAGCGCAGGCCGTCTACAAACGACAGCGAGGTGAGCTTTTCTTATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090721 Nonsense 936 991 20 21
ENSDART00000138355   None 126 None 6
ENSDART00000147623 Nonsense 856 911 21 22
Genomic Location (Zv9):
Chromosome 1 (position 10913936)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11046013
GRCz11 1 11732813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAWCCATCAAAAACACTCAGAYACCAAACGAGYGCAGGCCGTCTACAAA[C/T]GACAGCGAGGTGAGCTTTTCTTMTTATTATTATCATCAGTCTTTTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link