zgc:174575

Ensembl ID:
ENSDARG00000062593
ZFIN ID:
ZDB-GENE-030925-2
Description:
storkhead-box protein 1 [Source:RefSeq peptide;Acc:NP_001116482]
Human Orthologue:
STOX1
Human Description:
storkhead box 1 [Source:HGNC Symbol;Acc:23508]
Mouse Orthologue:
Stox1
Mouse Description:
storkhead box 1 Gene [Source:MGI Symbol;Acc:MGI:2684909]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38930 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090712 Nonsense 285 967 3 5
ENSDART00000127962 Nonsense 285 967 3 4
Genomic Location (Zv9):
Chromosome 13 (position 18546951)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18366986
GRCz11 13 18497978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCACTGGAAAAAGCCTCAAATGGCCTAAAGAACATAAGCCTTCTGTT[C/T]AGCACCAGTCCACATCTACCGCAGCAGATTACCAAGCCAGTGAGGTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link