si:dkey-151c10.1

Ensembl ID:
ENSDARG00000062590
ZFIN ID:
ZDB-GENE-030131-8984
Description:
si:dkey-151c10.1 [Source:RefSeq peptide;Acc:NP_001093502]
Human Orthologues:
EPPK1, PLEC
Human Descriptions:
epiplakin 1 [Source:HGNC Symbol;Acc:15577]
plectin [Source:HGNC Symbol;Acc:9069]
Mouse Orthologue:
Plec
Mouse Description:
plectin Gene [Source:MGI Symbol;Acc:MGI:1277961]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9648 Nonsense Available for shipment Available now
sa23511 Nonsense Available for shipment Available now
sa23510 Essential Splice Site Available for shipment Available now
sa11832 Nonsense Available for shipment Available now
sa8478 Nonsense Mutation detected in F1 DNA During 2018
sa36830 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43274 Nonsense Mutation detected in F1 DNA During 2018
sa14073 Nonsense Available for shipment Available now
sa43273 Nonsense Mutation detected in F1 DNA During 2018
sa7454 Missense Mutation detected in F1 DNA During 2018
sa10308 Nonsense Available for shipment Available now
sa10022 Nonsense Available for shipment Available now
sa3001 Nonsense F2 line generated During 2018
sa43272 Nonsense Mutation detected in F1 DNA During 2018
sa43271 Nonsense Mutation detected in F1 DNA During 2018
sa36829 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669   None 4762 None 35
ENSDART00000090679 Nonsense 4 4577 1 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22963091)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22894471
GRCz11 19 22478794
KASP Assay ID:
2261-3263.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGTMAGTGTGAAACTGGGTTCACACAAGGATAAGAAATGGCTGTCTA[T/G]AAAGGTTACAGAACGTACTCTACTGACAGTGTTGGCAGTGATGTGGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 470 4762 12 35
ENSDART00000090679 Nonsense 285 4577 9 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22935623)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22867003
GRCz11 19 22451326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACATTTTTATGTTGTGCACAGGAGTTGGAGTTGCGCTGGCAGGAATA[T/G]TATGAGCTGGTGACCATGTTACTGCAGTGGATCAGACATCATGTTATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Essential Splice Site 533 4762 13 35
ENSDART00000090679 Essential Splice Site 348 4577 10 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22935227)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22866607
GRCz11 19 22450930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGGAGACTGACAAAAATCGCTCCAAGCTTATTTACAAGTCATTTGAGG[T/C]AAGATTGCCAACAAAATTTTCTTTTATGAGAGTATGTAGAGCCAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 1094 4762 25 35
ENSDART00000090679 Nonsense 909 4577 22 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22919064)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22850444
GRCz11 19 22434767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCCTGTGGCAGAARCTGCATGTTGATATGAAGAGTCTGCTGTCCTGG[C/T]AGTACCTCATGAGAGACATCACGCTTATCAACTCCTGGAATTTCATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 1155 4762 26 35
ENSDART00000090679 Nonsense 970 4577 23 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22916661)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22848041
GRCz11 19 22432364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCAGGACTCTTCGGTGCTGATGATCGCATGCAGGCTGAAAACAGTTA[C/A]AACAAAGCCACTCAGCACTATGATAACCTGCTACGCTCTGTTGAACAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Essential Splice Site 1449 4762 30 35
ENSDART00000090679 Essential Splice Site 1264 4577 27 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22911223)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22842603
GRCz11 19 22426926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCATCGGTGGCAGCAAAGGCCTTCAGGAACAGCTTACACAGGAAAAG[G/A]TATTCATCCATCCATCTGAACAACATTCAAATGGTATAAAATATTCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 1520 4762 33 35
ENSDART00000090679 Nonsense 1335 4577 30 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22907329)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22838709
GRCz11 19 22423032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAATAACTTTAAAACCATCTTTCAGTATGTGACTCTGAGAACACGCTA[C/A]AGTGAGCTGATGACTCTTTCGAGTCAGTACATTAAATTCATCATTGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 1631 4762 34 35
ENSDART00000090679 Nonsense 1446 4577 31 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22905388)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22836768
GRCz11 19 22421091
KASP Assay ID:
2261-3256.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATCCAGCGRGAGCTTCAGGAGCTCAAAWCACTTTCGGARCAGGAAATC[A/T]AGGCTAAGTCTCAACAAGTAGAAGAGGCCCTCCTAAGCCGCACCAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 1702 4762 34 35
ENSDART00000090679 Nonsense 1517 4577 31 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22905175)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22836555
GRCz11 19 22420878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGAAATGCAGCACAGGAGGAGGCAGAGAAACTTAGGAAGCAAGTTGCT[G/T]AAGAAACTCAGAAGAAACGCAAGGCAGAAGAAGAGCTTAAACGGAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Missense 1982 4762 34 35
ENSDART00000090679 Missense 1797 4577 31 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22904334)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22835714
GRCz11 19 22420037
KASP Assay ID:
554-4085.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAAAGCTGAGAAAGAAACAATGTCAAATACTGAAAAGAGCAAACAAC[T/C]ACTTGAATCTGAAGCTGCCAAGATGAGGGAACTGGCTGAGGAGGCAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 2421 4762 34 35
ENSDART00000090679 Nonsense 2236 4577 31 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22903018)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22834398
GRCz11 19 22418721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATAAAGCAAAAGGCTCAAGTAGAAGATGAGCTMTCTAAAGTCAAGATT[C/T]AAATGGARGAYTTACTTAAACTRAAACTCAAAATWGAAAAGGAAAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 2916 4762 35 35
ENSDART00000090679 Nonsense 2731 4577 32 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22900217)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22831597
GRCz11 19 22415920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMAATCAAAAAATGAGCADCTATCAAGCTTTGAAAGACAAGATGATTACA[C/T]AAAGTACAGCTATAWTGCTTCTCGAAGCCCAAGCTGCATCTGGTTATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3001
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 2960 4762 35 35
ENSDART00000090679 Nonsense 2775 4577 32 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22900084)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22831464
GRCz11 19 22415787
KASP Assay ID:
554-2468.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGAATCTGTGAAGGATGGCTTGATTGGACCTGAGTTGCACACCAAGT[T/A]GTTATCTGCTGAAAGGGCTGTCACAGGATTYAAAGATCCGTTTACTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 3025 4762 35 35
ENSDART00000090679 Nonsense 2840 4577 32 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22899890)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22831270
GRCz11 19 22415593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTGATCCTGTCAATAGCCATCATGTACCAGTCCAATTGGCGTGCACA[C/T]AAGGTCAACTCGATGAAGATCTTAGCAAAATTCTGTCCAGCCCTCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 3384 4762 35 35
ENSDART00000090679 Nonsense 3199 4577 32 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22898811)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22830191
GRCz11 19 22414514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTGAGTACAGTATATGTTGACCCCAACACCCAAGAAAAAGTCACTTA[C/A]ACTGAACTGCTGAAAAGATGCATCACTGATAAGCAGACTGGTCTTCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090669 Nonsense 3523 4762 35 35
ENSDART00000090679 Nonsense 3338 4577 32 32
ENSDART00000141503   None 188 None 6

The following transcripts of ENSDARG00000062590 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 22898396)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22829776
GRCz11 19 22414099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTACTTGAATCTAAAATCATTGATAAAGACACCTATGATAAAATCCTA[C/T]AAGGCAAAAAGAAACCTGCTGAAGTTAGCGGGTCCGTCAAACAGTACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link