zgc:136845

Ensembl ID:
ENSDARG00000062585
ZFIN ID:
ZDB-GENE-060421-6989
Description:
BRCA1-associated protein required for ATM activation protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1RL
Human Orthologue:
C7orf27
Human Description:
chromosome 7 open reading frame 27 [Source:HGNC Symbol;Acc:21701]
Mouse Orthologue:
AA881470
Mouse Description:
EST AA881470 Gene [Source:MGI Symbol;Acc:MGI:1891679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31195 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090689 Nonsense 624 822 14 14
Genomic Location (Zv9):
Chromosome 1 (position 10852663)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10984740
GRCz11 1 11671540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCTGAAAGGGTCAAACCCCATAACAGCCCTGGACTCTTCCCTGAGCT[C/A]GGTCCTGTCTCTCGGGGGCAACGATTTTGACTGGGAAGTGAAAATGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link