si:dkeyp-7c9.1

Ensembl ID:
ENSDARG00000062579
ZFIN ID:
ZDB-GENE-070705-262
Description:
kremen protein 1 [Source:RefSeq peptide;Acc:NP_001108389]
Human Orthologue:
KREMEN1
Human Description:
kringle containing transmembrane protein 1 [Source:HGNC Symbol;Acc:17550]
Mouse Orthologue:
Kremen1
Mouse Description:
kringle containing transmembrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1933988]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33555 Essential Splice Site Available for shipment Available now
sa1168 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa33555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090684 Essential Splice Site 179 440 4 9
ENSDART00000141698 Essential Splice Site 179 289 4 6

The following transcripts of ENSDARG00000062579 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17945084)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15663608
GRCz11 5 16164169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCACACTCAGCCGTGTGGAGGAGATGGACGCATCATCGTCTTTGACAG[T/C]ACGTTTTCAAACCGTCATGACCTGTGCAGGGGACACAAAGCACAAAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1168
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090684 Nonsense 247 440 6 9
ENSDART00000141698 Nonsense 247 289 6 6

The following transcripts of ENSDARG00000062579 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17942059)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15660583
GRCz11 5 16161144
KASP Assay ID:
554-1078.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATCGTGGACCAAAAAGACATGGTGGAGCTGTTGGATGGTAAAACCAAC[C/T]AGGTTGTGGCACGATTTGACGGCCGCAATCCTCCACGGGACATCGTGAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link