si:dkeyp-7c9.3

Ensembl ID:
ENSDARG00000062573
ZFIN ID:
ZDB-GENE-070705-263
Description:
Novel protein similar to human and mouse zinc and ring finger 3 (ZNRF3) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
ZNRF3
Human Description:
zinc and ring finger 3 [Source:HGNC Symbol;Acc:18126]
Mouse Orthologue:
Znrf3
Mouse Description:
zinc and ring finger 3 Gene [Source:MGI Symbol;Acc:MGI:3039616]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45192 Nonsense Mutation detected in F1 DNA During 2018
sa9675 Nonsense Available for shipment Available now
sa20370 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090657 Nonsense 348 751 6 6
Genomic Location (Zv9):
Chromosome 5 (position 17906264)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15624788
GRCz11 5 16125349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATTTTCAAGGCTTGACCTTCCCACAACCTGAAGGTCAGCCTAGTAAT[G/T]GACTCCACAAAGGACACAATAGACCCTTCCAGCCAGGACTTCTGTATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090657 Nonsense 417 751 6 6
Genomic Location (Zv9):
Chromosome 5 (position 17906473)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15624997
GRCz11 5 16125558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGACTGTCCCGGAAGCGACAGCAGCAGTAGCTCGGGTCAGTGCCACTG[T/A]TCATCAAGCGACTCCATGTTGGATTGTACGGAGGTCAGCAACCAGGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090657 Nonsense 452 751 6 6
Genomic Location (Zv9):
Chromosome 5 (position 17906578)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15625102
GRCz11 5 16125663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGCTGCTCTACGTTTCGAAGTTCGCTAAGCAGCGATTACGATCCCTA[T/A]GTGTATCGCAGTAAGAGTCCATGTCGGGGGTCAGCTGGGGAGGCTGGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link