
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:172238
- Ensembl ID:
- ENSDARG00000062543
- ZFIN ID:
- ZDB-GENE-080215-23
- Description:
- MAP7 domain containing 1 [Source:RefSeq peptide;Acc:NP_001107107]
- Human Orthologue:
- MAP7D1
- Human Description:
- MAP7 domain containing 1 [Source:HGNC Symbol;Acc:25514]
- Mouse Orthologue:
- Mtap7d1
- Mouse Description:
- microtubule-associated protein 7 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384297]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43207 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa926 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43207
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090587 | Nonsense | 117 | 728 | 4 | 17 |
ENSDART00000124431 | Nonsense | 114 | 725 | 4 | 17 |
ENSDART00000127812 | Nonsense | 124 | 770 | 5 | 25 |
- Genomic Location (Zv9):
- Chromosome 19 (position 4755237)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 4028798 GRCz11 19 3959624 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATTGAAAACTCTTTATCTTCTCTCTCTCAGCGGCAAAGAAAGCGCAGTG[G/A]TTGGAGAAGGAGGAGAAGGCCCGGCGGCTGCGTGAGAGTCAGCTGGAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa926
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090587 | Nonsense | 213 | 728 | 6 | 17 |
ENSDART00000124431 | Nonsense | 210 | 725 | 6 | 17 |
ENSDART00000127812 | Nonsense | 255 | 770 | 8 | 25 |
- Genomic Location (Zv9):
- Chromosome 19 (position 4741422)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 4014983 GRCz11 19 3945809 - KASP Assay ID:
- 554-0831.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCACCCTCTTGTGTCAGCCCGCAGTTTGCGCTTGAGCCCGTGGGAGAGT[C/T]GAATCGTGGAGCGACTGATGACGCCTACCCTTTCCTTTCTGGCYCGCAGC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: