zgc:172238

Ensembl ID:
ENSDARG00000062543
ZFIN ID:
ZDB-GENE-080215-23
Description:
MAP7 domain containing 1 [Source:RefSeq peptide;Acc:NP_001107107]
Human Orthologue:
MAP7D1
Human Description:
MAP7 domain containing 1 [Source:HGNC Symbol;Acc:25514]
Mouse Orthologue:
Mtap7d1
Mouse Description:
microtubule-associated protein 7 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43207 Nonsense Mutation detected in F1 DNA During 2018
sa926 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090587 Nonsense 117 728 4 17
ENSDART00000124431 Nonsense 114 725 4 17
ENSDART00000127812 Nonsense 124 770 5 25
Genomic Location (Zv9):
Chromosome 19 (position 4755237)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4028798
GRCz11 19 3959624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGAAAACTCTTTATCTTCTCTCTCTCAGCGGCAAAGAAAGCGCAGTG[G/A]TTGGAGAAGGAGGAGAAGGCCCGGCGGCTGCGTGAGAGTCAGCTGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090587 Nonsense 213 728 6 17
ENSDART00000124431 Nonsense 210 725 6 17
ENSDART00000127812 Nonsense 255 770 8 25
Genomic Location (Zv9):
Chromosome 19 (position 4741422)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4014983
GRCz11 19 3945809
KASP Assay ID:
554-0831.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACCCTCTTGTGTCAGCCCGCAGTTTGCGCTTGAGCCCGTGGGAGAGT[C/T]GAATCGTGGAGCGACTGATGACGCCTACCCTTTCCTTTCTGGCYCGCAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link