
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mapk8ip3
- Ensembl ID:
- ENSDARG00000062531
- ZFIN ID:
- ZDB-GENE-090303-6
- Human Orthologue:
- MAPK8IP3
- Human Description:
- mitogen-activated protein kinase 8 interacting protein 3 [Source:HGNC Symbol;Acc:6884]
- Mouse Orthologue:
- Mapk8ip3
- Mouse Description:
- mitogen-activated protein kinase 8 interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:1353598]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8849 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40025 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8849
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090496 | Nonsense | 179 | 1311 | 4 | 34 |
ENSDART00000139206 | Nonsense | 179 | 1302 | 4 | 31 |
- Genomic Location (Zv9):
- Chromosome 3 (position 15526597)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 15772198 GRCz11 3 15921998 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCTCCAGATGATTMAGACATATGTGGAACACATTGAACGCTCAAAGTTG[C/T]AGCWGTCAGGCAGCAACCAGTCTGAATCCACAGGCTGCGGACGGTCGTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40025
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090496 | Nonsense | 962 | 1311 | 26 | 34 |
ENSDART00000139206 | Nonsense | 953 | 1302 | 23 | 31 |
- Genomic Location (Zv9):
- Chromosome 3 (position 15578799)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 15824400 GRCz11 3 15974200 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCCATCTCAGACATCATATGCATCATGTAAACTCTCTCCACAGGCTGTA[T/A]GTCCACTCTGCAGTGTCCAACTGGAAGAAATGCCTCCATTCGATTAAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: