zc3h18

Ensembl ID:
ENSDARG00000062506
ZFIN ID:
ZDB-GENE-050419-13
Description:
Zinc finger CCCH domain-containing protein 18 [Source:UniProtKB/Swiss-Prot;Acc:Q1LUE5]
Human Orthologue:
ZC3H18
Human Description:
zinc finger CCCH-type containing 18 [Source:HGNC Symbol;Acc:25091]
Mouse Orthologue:
Zc3h18
Mouse Description:
zinc finger CCCH-type containing 18 Gene [Source:MGI Symbol;Acc:MGI:1923264]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36616 Nonsense Available for shipment Available now
sa23270 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090446 Nonsense 447 1148 5 17
ENSDART00000124010   None 284 None 2
ENSDART00000135597   None 218 None 5
ENSDART00000141873 Nonsense 447 1148 6 18
Genomic Location (Zv9):
Chromosome 18 (position 16794381)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17146147
GRCz11 18 17135213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAAAAACAAATGCTTTCGTTCAGGTGTTAAAAAAAGCCACCATACGT[A/T]AAGAGCAGGAGCCAGATTTTGAGGAAAAACGTTTCACCGTGACCATCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090446 Essential Splice Site 1010 1148 14 17
ENSDART00000124010   None 284 None 2
ENSDART00000135597 Essential Splice Site 81 218 2 5
ENSDART00000141873 Essential Splice Site 1010 1148 15 18
Genomic Location (Zv9):
Chromosome 18 (position 16743831)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17095597
GRCz11 18 17084663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGGATATGGCTCTCATAAGGACATCAAGCTCACCCTGCTCAACAAG[G/A]TAAATGAGAGAAAACACATGAATGTCACGGCCATGGAGCTGCGCAGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link