vcam1

Ensembl ID:
ENSDARG00000062479
ZFIN ID:
ZDB-GENE-070209-238
Description:
vascular cell adhesion protein 1 [Source:RefSeq peptide;Acc:NP_001077304]
Human Orthologue:
VCAM1
Human Description:
vascular cell adhesion molecule 1 [Source:HGNC Symbol;Acc:12663]
Mouse Orthologue:
Vcam1
Mouse Description:
vascular cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:98926]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31070 Nonsense Mutation detected in F1 DNA During 2018
sa10702 Nonsense Available for shipment Available now
sa24124 Essential Splice Site Available for shipment Available now
sa9939 Essential Splice Site Available for shipment Available now
sa45764 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090390 Nonsense 11 808 1 10
Genomic Location (Zv9):
Chromosome 22 (position 16394983)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16153605
GRCz11 22 16179875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCATAAGTGTACAACATGGATACAGCTTTCTTGCTGACTTTGCTTT[T/A]GCCAGTTGCAGGTAAGTTTCATCTGTTAGTAATTTAACTGCATATGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090390 Nonsense 116 808 3 10
Genomic Location (Zv9):
Chromosome 22 (position 16393074)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16151696
GRCz11 22 16177966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGGAATCCATTTCAGCTTTTCCAAGAAACCCAGTTATATCCGGAYA[T/A]GATCACTTGATAATGGGCAAGGAAAACRTTTTGTCCTGTGAAGTGTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090390 Essential Splice Site 383 808 5 10
Genomic Location (Zv9):
Chromosome 22 (position 16392064)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16150686
GRCz11 22 16176956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAATGAGTATGGCAGTCAGAGGACCACTCTTAATCTAAATGTTGAGG[G/A]TAAGACATTGGTGGATTTTGTGGTACTAAATTTGGTCTGTTGAGCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090390 Essential Splice Site 384 808 6 10
Genomic Location (Zv9):
Chromosome 22 (position 16391351)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16149973
GRCz11 22 16176243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTYGGAGGTGACACGGTACARCTCTTAACTTTCTTTTAATTGTCTTGCA[G/A]CTCATTTGCTGGAMGTGGAGCTRCAACCAAATGGCACGGTGGTGTCCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090390 Nonsense 514 808 7 10
Genomic Location (Zv9):
Chromosome 22 (position 16389478)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16148100
GRCz11 22 16174370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCACTGTTCAAGACGTATTCCCTGTCAACCTTTTCCAAATTCTGTG[G/A]CTGGATGGAGAAAGAGAAATCTGGAGAGAGGAATCTCAGTCATTTTCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link