si:dkeyp-74a11.11

Ensembl ID:
ENSDARG00000062478
ZFIN IDs:
ZDB-GENE-070301-5, ZDB-GENE-070301-5, ZDB-GENE-090312-20
Description:
chemokine receptor 7b [Source:RefSeq peptide;Acc:NP_001138286]
Human Orthologue:
CXCR7
Human Description:
chemokine (C-X-C motif) receptor 7 [Source:HGNC Symbol;Acc:23692]
Mouse Orthologue:
Cxcr7
Mouse Description:
chemokine (C-X-C motif) receptor 7 Gene [Source:MGI Symbol;Acc:MGI:109562]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34640 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090414 Nonsense 221 403 2 2
ENSDART00000101588 Nonsense 178 360 1 1
Genomic Location (Zv9):
Chromosome 9 (position 25079033)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24234819
GRCz11 9 24045688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCCTCAGTACCCGACACATACTTCCTGCGGTCTGTAAAGTCACAATA[C/A]AGTCACGTGACCTTGTGTCTTCCTGTATACCCAGAGGACAACCCTTTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link