zgc:154141

Ensembl ID:
ENSDARG00000062471
ZFIN ID:
ZDB-GENE-061013-164
Description:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 [Source:RefSeq peptide;A
Human Orthologue:
FAM19A4
Human Description:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 [Source:HGNC Symbol;Acc:2
Mouse Orthologue:
Fam19a4
Mouse Description:
family with sequence similarity 19, member A4 Gene [Source:MGI Symbol;Acc:MGI:2444563]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21877 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090401 Essential Splice Site 1 135 3 6
Genomic Location (Zv9):
Chromosome 11 (position 18170250)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 17536086
GRCz11 11 17670721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTAGTGCACACTTCTAAGAGCCCTTCTCTGTATGCTGCTCTCTTCT[A/T]GATGCAGCTGTGGGGTCGATCTCTGTGGCCGCTGCGGATTGTGCTCTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link