zgc:162946

Ensembl ID:
ENSDARG00000062467
ZFIN ID:
ZDB-GENE-070410-116
Description:
hypothetical protein LOC100000104 [Source:RefSeq peptide;Acc:NP_001082917]
Mouse Orthologue:
1300002K09Rik
Mouse Description:
RIKEN cDNA 1300002K09 gene Gene [Source:MGI Symbol;Acc:MGI:1921402]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10706 Essential Splice Site Available for shipment Available now
sa32616 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090380 Essential Splice Site 173 609 5 16
ENSDART00000123998 Essential Splice Site 210 646 7 18
ENSDART00000142081 Essential Splice Site 173 609 6 17
ENSDART00000146842 Essential Splice Site 173 234 6 9

The following transcripts of ENSDARG00000062467 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 11477827)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11494656
GRCz11 1 12181456
KASP Assay ID:
2259-0304.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCATTGTGAAGGCGGTACGCATCCATCTGAAGCTACAAGCKGATGAG[G/A]TCAGATCATGGAGCACTTTTTTAGTCAGCAATTTTTTATATTTTTACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090380 Nonsense 410 609 13 16
ENSDART00000123998 Nonsense 447 646 15 18
ENSDART00000142081 Nonsense 410 609 14 17
ENSDART00000146842   None 234 None 9

The following transcripts of ENSDARG00000062467 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 11482631)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11499460
GRCz11 1 12186260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTGACAATATTTATAGTTATAGCTTTGGTGGTCCTGCAGATTATTT[T/A]GGTCCAAGTGTTTTTCCTGCAGGACAAACTCTCCCCTGAAGACAAAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link