zc3h12b

Ensembl ID:
ENSDARG00000062463
ZFIN ID:
ZDB-GENE-060526-290
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CF02]
Human Orthologue:
ZC3H12B
Human Description:
zinc finger CCCH-type containing 12B [Source:HGNC Symbol;Acc:17407]
Mouse Orthologue:
Zc3h12b
Mouse Description:
zinc finger CCCH-type containing 12B Gene [Source:MGI Symbol;Acc:MGI:2442133]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10386 Nonsense Available for shipment Available now
sa7561 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090375 Nonsense 30 797 1 7
ENSDART00000143676 Nonsense 59 838 1 5
Genomic Location (Zv9):
Chromosome 5 (position 23882092)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21594964
GRCz11 5 22098764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTTTGGACCGTCCCAGCTTCAGYCAGAGCAGCACCTTACAAGAGTTA[C/T]GAGCAGATGACACCTGCACCGACCCRTCCCAGAAAGCCCTTGCTCCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090375 Missense 434 797 5 7
ENSDART00000143676 Missense 463 838 5 5
Genomic Location (Zv9):
Chromosome 5 (position 23888793)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21601665
GRCz11 5 22105465
KASP Assay ID:
554-4062.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTACCGTCTTTAGTGTCCGCTCTTAGCGTCCCCACTATGCCACTAA[C/T]AAAGAGTCATGCAGCTGGCGCTTTGAACACACGATCGGCTAGCAGCCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link