zgc:152692

Ensembl ID:
ENSDARG00000062432
ZFIN ID:
ZDB-GENE-060929-1218
Description:
hypothetical protein LOC767740 [Source:RefSeq peptide;Acc:NP_001070177]
Human Orthologue:
GPR132
Human Description:
G protein-coupled receptor 132 [Source:HGNC Symbol;Acc:17482]
Mouse Orthologue:
Gpr132
Mouse Description:
G protein-coupled receptor 132 Gene [Source:MGI Symbol;Acc:MGI:1890220]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13230 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090302 Nonsense 215 258 2 3
ENSDART00000130146 Nonsense 217 334 2 2
Genomic Location (Zv9):
Chromosome 15 (position 12269333)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 11976884
GRCz11 15 11908301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTATAACGGTCTGCTACTGCTTGATCCCTACCAAGGTACAGCAAAGC[A/T]GAGGGGTTGACGATCAAGGCAAGCGCAAAKTGAAGCTTCTGTCTATGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link