zgc:136894

Ensembl ID:
ENSDARG00000062429
ZFIN ID:
ZDB-GENE-060616-101
Description:
hypothetical protein LOC723998 [Source:RefSeq peptide;Acc:NP_001038768]
Human Orthologue:
TRIM69
Human Description:
tripartite motif-containing 69 [Source:HGNC Symbol;Acc:17857]
Mouse Orthologue:
Trim69
Mouse Description:
tripartite motif-containing 69 Gene [Source:MGI Symbol;Acc:MGI:1918178]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36070 Nonsense Mutation detected in F1 DNA During 2018
sa22785 Essential Splice Site Available for shipment Available now
sa22784 Essential Splice Site Available for shipment Available now
sa1620 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Nonsense 240 497 3 6
Genomic Location (Zv9):
Chromosome 16 (position 15836074)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14180966
GRCz11 16 14071086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGATGAAAAGAAACAGAGCAGAAATAGAAGAGAAGCTGAATGATGGA[C/T]GAGAGAAGGAAGGGATTCTGCACTCAGTCTTGGACACTGATCAGCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Essential Splice Site 260 497 3 6
Genomic Location (Zv9):
Chromosome 16 (position 15836010)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14180902
GRCz11 16 14071022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCTGCACTCAGTCTTGGACACTGATCAGCCAGATGGATTTCTGCAGG[T/C]TATATTCAAATATTTGTATTCAGCACAATTACAATTTTGGATGCTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Essential Splice Site 329 497 5 6
Genomic Location (Zv9):
Chromosome 16 (position 15832920)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14177812
GRCz11 16 14067932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCTGCAGTTTATTGTTTGGAAGGAGATGCTGGGGTCTGTCAAACCAG[G/A]TAAGAAGATCACTGATCTGTACTGTAGTAGACAACACACACTTTACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Nonsense 366 497 6 6
Genomic Location (Zv9):
Chromosome 16 (position 15829974)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14174866
GRCz11 16 14064986
KASP Assay ID:
554-1561.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGACGCAGCGTCATCCGCACTTCCAAAAAGGGGATTTTCTTGCGTCAC[A/T]AAGACTACAGACCTCTGGCCAGGACCCACAAGACCTTCCAGACGGGACAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link