
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nfia
- Ensembl ID:
- ENSDARG00000062420
- ZFIN ID:
- ZDB-GENE-050208-501
- Description:
- nuclear factor 1 A-type [Source:RefSeq peptide;Acc:NP_001073431]
- Human Orthologue:
- NFIA
- Human Description:
- nuclear factor I/A [Source:HGNC Symbol;Acc:7784]
- Mouse Orthologue:
- Nfia
- Mouse Description:
- nuclear factor I/A Gene [Source:MGI Symbol;Acc:MGI:108056]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16768 | Nonsense | Available for shipment | Available now |
sa24138 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16768
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063467 | Nonsense | 232 | 524 | 4 | 12 |
ENSDART00000090237 | Nonsense | 232 | 481 | 4 | 11 |
ENSDART00000090242 | Nonsense | 232 | 507 | 4 | 11 |
ENSDART00000138233 | Nonsense | 232 | 507 | 4 | 11 |
ENSDART00000138382 | 254 | 254 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 17121642)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16873400 GRCz11 22 16899670 - KASP Assay ID:
- 2261-6671.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTCGTCACATCAGGTGTCTTCACCGTCTCTGAGCTAGTGCGAGTCTCA[C/T]AGAGTAAGATCTCCACATCTTATAATGATTATTCTTCCTKTTGGGACATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24138
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063467 | Nonsense | 367 | 524 | 8 | 12 |
ENSDART00000090237 | None | 481 | None | 11 | |
ENSDART00000090242 | Nonsense | 350 | 507 | 7 | 11 |
ENSDART00000138233 | Nonsense | 350 | 507 | 7 | 11 |
ENSDART00000138382 | None | 254 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 17096610)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16848368 GRCz11 22 16874638 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTGCCTTCGCAGACCGCTTCCCCCCGAACGGCATTCACACACCATCAT[C/T]GACCTGTCATTACAGGACCCAGAGGTGAGGTCCCAACACCCCACCCTCCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Genome-wide association of bipolar disorder suggests an enrichment of replicable associations in regions near genes. (View Study)
- Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
- Electrocardiographic conduction measures: Genome- and phenome-wide analyses of cardiac conduction identifies markers of arrhythmia risk. (View Study)
- Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)
- Thyroid hormone levels: A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function. (View Study)
- Ventricular conduction: Common variants in 22 loci are associated with QRS duration and cardiac ventricular conduction. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: