zgc:153332

Ensembl ID:
ENSDARG00000062418
ZFIN ID:
ZDB-GENE-060929-608
Description:
tubulin--tyrosine ligase [Source:RefSeq peptide;Acc:NP_001070093]
Human Orthologue:
TTL
Human Description:
tubulin tyrosine ligase [Source:HGNC Symbol;Acc:21586]
Mouse Orthologue:
Ttl
Mouse Description:
tubulin tyrosine ligase Gene [Source:MGI Symbol;Acc:MGI:1916987]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24929 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18309 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090273 Essential Splice Site 161 307 3 5
ENSDART00000123869 Essential Splice Site 161 404 3 7
ENSDART00000142732 Essential Splice Site 157 400 3 7
Genomic Location (Zv9):
Chromosome 13 (position 15879571)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15794604
GRCz11 13 15925596
KASP Assay ID:
554-7374.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGAGATGGGACAGTGTGGATAGCCAAATCATCAGCAGGCGCAAAAGG[T/A]AAAAAATCTCTGTTGATCCAAAAGACTGTTAAGATATAAACAAAGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090273 Nonsense 248 307 5 5
ENSDART00000123869 Nonsense 248 404 5 7
ENSDART00000142732 Nonsense 244 400 5 7
Genomic Location (Zv9):
Chromosome 13 (position 15878605)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15793638
GRCz11 13 15924630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAACAGCTCAGATCTYCAGAATATGACCAGTCATCTGACAAACCACTG[T/A]ATTCAGAAAGAGCATTCGCARAACTATGGCCKAWATGAGGAGGGCAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link