
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
znf319
- Ensembl ID:
- ENSDARG00000062401
- ZFIN ID:
- ZDB-GENE-090406-2
- Human Orthologue:
- ZNF319
- Human Description:
- zinc finger protein 319 [Source:HGNC Symbol;Acc:13644]
- Mouse Orthologue:
- Zfp319
- Mouse Description:
- zinc finger protein 319 Gene [Source:MGI Symbol;Acc:MGI:1890618]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12083 | Nonsense | Available for shipment | Available now |
sa6128 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa6127 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa711 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12083
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090226 | Nonsense | 21 | 584 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 25 (position 14106454)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 13578029 GRCz11 25 13674429 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTCAAAGCTGAATCCATACACTAGAGCCCGGATGACGGAGGCGTGGCAG[C/T]AGCATGCTGTTGCCCCGCCTCCAGTGGTGCACAYCATCCCACCAGGGGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6128
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090226 | Essential Splice Site | 54 | 584 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 25 (position 14106352)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 13577927 GRCz11 25 13674327 - KASP Assay ID:
- 554-3825.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGCACTGGGCTGCACCGTCTATGGCATCGTCCTSCAGCCGGACACGACA[T/C]TGCAGCAACAACARCAGCANNNGCARCAACAACAGCAGCAGCACCACAGTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6127
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090226 | Essential Splice Site | 428 | 584 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 25 (position 14105144)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 13576719 GRCz11 25 13673119 - KASP Assay ID:
- 554-3824.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTGGCAAGGGCTTCAGCCAGTCCGGRGAGCTGCTTCGTCAYAAATGTGG[T/C]GAGTCTTCCTCAACACCCACAAATCCAGACAAGCCCTACAAGTGTGACGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa711
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090226 | Nonsense | 465 | 584 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 25 (position 14105020)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 13576595 GRCz11 25 13672995 - KASP Assay ID:
- 554-0619.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCACAACTCTACAGCGGCATCAGAACTCCCACTGCACAGAGAAACCTCTC[A/T]AGTGCTCGCTGTGTGACCGACGCTTCCTTTCCTCCTCAGAGTTTGTGCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: