znf319

Ensembl ID:
ENSDARG00000062401
ZFIN ID:
ZDB-GENE-090406-2
Human Orthologue:
ZNF319
Human Description:
zinc finger protein 319 [Source:HGNC Symbol;Acc:13644]
Mouse Orthologue:
Zfp319
Mouse Description:
zinc finger protein 319 Gene [Source:MGI Symbol;Acc:MGI:1890618]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12083 Nonsense Available for shipment Available now
sa6128 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6127 Essential Splice Site Mutation detected in F1 DNA During 2018
sa711 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Nonsense 21 584 1 3
Genomic Location (Zv9):
Chromosome 25 (position 14106454)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13578029
GRCz11 25 13674429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAAAGCTGAATCCATACACTAGAGCCCGGATGACGGAGGCGTGGCAG[C/T]AGCATGCTGTTGCCCCGCCTCCAGTGGTGCACAYCATCCCACCAGGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Essential Splice Site 54 584 1 3
Genomic Location (Zv9):
Chromosome 25 (position 14106352)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13577927
GRCz11 25 13674327
KASP Assay ID:
554-3825.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCACTGGGCTGCACCGTCTATGGCATCGTCCTSCAGCCGGACACGACA[T/C]TGCAGCAACAACARCAGCANNNGCARCAACAACAGCAGCAGCACCACAGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Essential Splice Site 428 584 2 3
Genomic Location (Zv9):
Chromosome 25 (position 14105144)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13576719
GRCz11 25 13673119
KASP Assay ID:
554-3824.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGCAAGGGCTTCAGCCAGTCCGGRGAGCTGCTTCGTCAYAAATGTGG[T/C]GAGTCTTCCTCAACACCCACAAATCCAGACAAGCCCTACAAGTGTGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Nonsense 465 584 3 3
Genomic Location (Zv9):
Chromosome 25 (position 14105020)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13576595
GRCz11 25 13672995
KASP Assay ID:
554-0619.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAACTCTACAGCGGCATCAGAACTCCCACTGCACAGAGAAACCTCTC[A/T]AGTGCTCGCTGTGTGACCGACGCTTCCTTTCCTCCTCAGAGTTTGTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link