
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-238n5.4
- Ensembl ID:
- ENSDARG00000062381
- ZFIN ID:
- ZDB-GENE-050419-80
- Description:
- Protein LCHN [Source:UniProtKB/Swiss-Prot;Acc:Q1LX49]
- Human Orthologue:
- KIAA1147
- Human Description:
- KIAA1147 [Source:HGNC Symbol;Acc:29472]
- Mouse Orthologue:
- E330009J07Rik
- Mouse Description:
- RIKEN cDNA E330009J07 gene Gene [Source:MGI Symbol;Acc:MGI:2444256]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43090 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32203 | Nonsense | Available for shipment | Available now |
sa16749 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43090
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077076 | Nonsense | 53 | 410 | 1 | 9 |
ENSDART00000090186 | Nonsense | 53 | 493 | 1 | 11 |
ENSDART00000141367 | Nonsense | 53 | 490 | 1 | 9 |
- Genomic Location (Zv9):
- Chromosome 18 (position 20340365)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20570588 GRCz11 18 20559654 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGGCTATCAAGTTACCCAACTGAGGCCACATTAGGGGCAGATATCACCT[T/A]GAACACGAGCCCGACGAGACCGAGCAGTGTAGCAGCTGTTCATTCTCCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32203
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077076 | Nonsense | 366 | 410 | 7 | 9 |
ENSDART00000090186 | Nonsense | 366 | 493 | 7 | 11 |
ENSDART00000141367 | Nonsense | 366 | 490 | 7 | 9 |
- Genomic Location (Zv9):
- Chromosome 18 (position 20325660)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20555883 GRCz11 18 20544949 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTTCTCAGGTACCACAGAGAAGATCTTTGAGGAAAAGAAGGAGCTGTA[T/A]GATGTGTACATTGACAATCAGAACGTGAAGACGCACAGAGAGAGTCTCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16749
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077076 | None | 410 | None | 9 | |
ENSDART00000090186 | Essential Splice Site | None | 493 | 10 | 11 |
ENSDART00000141367 | None | 490 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 18 (position 20323876)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 20554099 GRCz11 18 20543165 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCCTGACCCCTCTGGACCACACTGATACTGCCAACACCAACAACCCAAG[T/A]CCGTCTACAGGCTTTTTCGCGCAGCCAGTGGCGTCTTTCTGCTTCTCTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: