zgc:153507

Ensembl ID:
ENSDARG00000062379
ZFIN ID:
ZDB-GENE-061103-595
Description:
Probable UDP-sugar transporter protein SLC35A4 [Source:UniProtKB/Swiss-Prot;Acc:A0JMG9]
Human Orthologue:
SLC35A4
Human Description:
solute carrier family 35, member A4 [Source:HGNC Symbol;Acc:20753]
Mouse Orthologue:
Slc35a4
Mouse Description:
solute carrier family 35, member A4 Gene [Source:MGI Symbol;Acc:MGI:1915093]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14862 Nonsense Available for shipment Available now
sa971 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090196 Nonsense 191 314 1 1
Genomic Location (Zv9):
Chromosome 14 (position 3110047)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2813802
GRCz11 14 3064919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACATCACTTCCTGGGGTYTGCWGTTGGTTCTTGTGTATTGTTTTGTGT[C/A]GGGTTTGGCTGCCRTTTATACCGAACGCGTGCTGAAAAGYCAACGTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090196 Nonsense 313 314 1 1
Genomic Location (Zv9):
Chromosome 14 (position 3110414)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2813435
GRCz11 14 3064552
KASP Assay ID:
554-0876.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTCCTGTTTCCTGTTGTGCTGATTGGATGGGCGGTGTACCTGTATTA[T/A]ACGTAAAGGAGTAACCACTGACAACCGCATTTAAGTAATTGCTTTATAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link