
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153507
- Ensembl ID:
- ENSDARG00000062379
- ZFIN ID:
- ZDB-GENE-061103-595
- Description:
- Probable UDP-sugar transporter protein SLC35A4 [Source:UniProtKB/Swiss-Prot;Acc:A0JMG9]
- Human Orthologue:
- SLC35A4
- Human Description:
- solute carrier family 35, member A4 [Source:HGNC Symbol;Acc:20753]
- Mouse Orthologue:
- Slc35a4
- Mouse Description:
- solute carrier family 35, member A4 Gene [Source:MGI Symbol;Acc:MGI:1915093]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14862 | Nonsense | Available for shipment | Available now |
sa971 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14862
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090196 | Nonsense | 191 | 314 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 14 (position 3110047)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 2813802 GRCz11 14 3064919 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTACATCACTTCCTGGGGTYTGCWGTTGGTTCTTGTGTATTGTTTTGTGT[C/A]GGGTTTGGCTGCCRTTTATACCGAACGCGTGCTGAAAAGYCAACGTCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa971
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090196 | Nonsense | 313 | 314 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 14 (position 3110414)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 2813435 GRCz11 14 3064552 - KASP Assay ID:
- 554-0876.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACTTCCTGTTTCCTGTTGTGCTGATTGGATGGGCGGTGTACCTGTATTA[T/A]ACGTAAAGGAGTAACCACTGACAACCGCATTTAAGTAATTGCTTTATAAA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: