zgc:154073

Ensembl ID:
ENSDARG00000062374
ZFIN ID:
ZDB-GENE-061013-607
Description:
leukocyte receptor cluster member 9 [Source:RefSeq peptide;Acc:NP_001070766]
Human Orthologue:
LENG9
Human Description:
leukocyte receptor cluster (LRC) member 9 [Source:HGNC Symbol;Acc:16306]
Mouse Orthologue:
Leng9
Mouse Description:
leukocyte receptor cluster (LRC) member 9 Gene [Source:MGI Symbol;Acc:MGI:2444509]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36067 Missense, Nonsense Mutation detected in F1 DNA During 2018
sa28608 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090183 Missense 68 542 4 7
ENSDART00000132982 Missense 68 225 4 7
ENSDART00000144856 Missense 68 542 5 8
ENSDART00000146719 Nonsense 83 140 4 6
Genomic Location (Zv9):
Chromosome 16 (position 15566676)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13925135
GRCz11 16 13815255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGTGTGCTTGACGTCCCACAAACCACAAACTCCGAGAAAGACGATA[C/T]AGCCGTCACAGAAAAGCAGAGCAAGAGCCGAAAAAATGGGAAAAAATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090183 Nonsense 311 542 7 7
ENSDART00000132982   None 225 None 7
ENSDART00000144856 Nonsense 311 542 8 8
ENSDART00000146719   None 140 None 6
Genomic Location (Zv9):
Chromosome 16 (position 15562233)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13920692
GRCz11 16 13810812
KASP Assay ID:
2260-9376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTTTAAATCATTTGGCTGGAAATCTGACTATCACTCAAAAAGATGAA[C/T]AAGCGGAAATAGCGGAGGAATGGAAGGACAGCTGGGATGGAGTGAGTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link