zgc:158234

Ensembl ID:
ENSDARG00000062361
ZFIN ID:
ZDB-GENE-070112-2352
Description:
GC-rich sequence DNA-binding factor homolog [Source:RefSeq peptide;Acc:NP_001073652]
Human Orthologue:
GCFC1
Human Description:
GC-rich sequence DNA-binding factor 1 [Source:HGNC Symbol;Acc:13579]
Mouse Orthologue:
Gcfc1
Mouse Description:
GC-rich sequence DNA-binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:1914617]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8635 Nonsense Mutation detected in F1 DNA During 2018
sa34903 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090096 Nonsense 100 897 2 18
ENSDART00000109663 Nonsense 100 356 2 14
ENSDART00000139332   None 127 None 6
ENSDART00000139850 Nonsense 100 894 2 18
ENSDART00000140572 Nonsense 100 723 2 13

The following transcripts of ENSDARG00000062361 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 24854978)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24454330
GRCz11 10 24423782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCACTGTGCATCTGTCACTATTAGATGAAGCAGAAGTTTTYCGTGTG[A/T]AGAAGTCCAACCACAGCAAGAAGATCGTCAAGCAGCTCAAGAAAGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090096 Essential Splice Site 480 897 None 18
ENSDART00000109663 Essential Splice Site None 356 None 14
ENSDART00000139332 Essential Splice Site 101 127 None 6
ENSDART00000139850 Essential Splice Site 477 894 None 18
ENSDART00000140572 Essential Splice Site 477 723 None 13

The following transcripts of ENSDARG00000062361 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 24860656)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24460008
GRCz11 10 24429460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGGTGAATTTAGCTTTACTGAAGGCTAATATCAGTTCTTTCCTTTTC[A/T]GGTAAGGCTGTTATGGCCCCTAACCTGGACTCATTTGGCCGAGATCGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link