
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-171o17.5
- Ensembl ID:
- ENSDARG00000062355
- ZFIN ID:
- ZDB-GENE-050208-341
- Description:
- hypothetical protein LOC557839 [Source:RefSeq peptide;Acc:NP_001082846]
- Human Orthologue:
- C1orf125
- Human Description:
- chromosome 1 open reading frame 125 [Source:HGNC Symbol;Acc:26564]
- Mouse Orthologue:
- 9430070O13Rik
- Mouse Description:
- RIKEN cDNA 9430070O13 gene Gene [Source:MGI Symbol;Acc:MGI:1924602]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37485 | Nonsense | Available for shipment | Available now |
sa755 | Nonsense | Available for shipment | Available now |
sa10715 | Nonsense | Available for shipment | Available now |
sa18502 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37485
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090069 | Nonsense | 247 | 1007 | 8 | 25 |
ENSDART00000136908 | None | 364 | None | 10 |
- Genomic Location (Zv9):
- Chromosome 22 (position 17463410)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 17215168 GRCz11 22 17241438 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAATGTATTTCTATATTATTTTTCAGATCGAAAATTTACTAGAGCTGATT[C/T]AAACTGAGCAGAACATCTACAATATAGTGTTTCATGAGGTAATCCGGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa755
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090069 | Nonsense | 291 | 1007 | 9 | 25 |
ENSDART00000136908 | None | 364 | None | 10 |
- Genomic Location (Zv9):
- Chromosome 22 (position 17467559)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 17219317 GRCz11 22 17245587 - KASP Assay ID:
- 554-0662.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTTTTTCTTGGCTAGGCAAAAGTATGTGGCTCTACTTGACCGTATCCCA[C/T]GACAGGTGAAGGGTCTTCACACACAAACCTTAGCACAGAGGGCTCTGGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10715
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090069 | Nonsense | 374 | 1007 | 11 | 25 |
ENSDART00000136908 | None | 364 | None | 10 |
- Genomic Location (Zv9):
- Chromosome 22 (position 17468227)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 17219985 GRCz11 22 17246255 - KASP Assay ID:
- 2261-6678.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACTTCTCATCAGTATTGTAGCAGAGTACCATGAACTCTATGAGCTACAG[C/T]GAAAGAGACTTGAAGGACAGATGTCCCATTTAGATGGCGAAAGGGACYTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18502
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090069 | Essential Splice Site | 923 | 1007 | 23 | 25 |
ENSDART00000136908 | Essential Splice Site | 280 | 364 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 22 (position 17472343)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 17224101 GRCz11 22 17250371 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGCCTTCAGTTCTTTAGAAACAATCAGAACYCTTCAGCAAGAGCTTCTG[T/G]AAGTATTCGAATGGAAATCTSTCTTTAGTCAGATCTATAGGAATCTCTTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: