si:dkey-78d16.2

Ensembl ID:
ENSDARG00000062352
ZFIN ID:
ZDB-GENE-060503-363
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L8P6]
Human Orthologue:
SEMA4A
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4a
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45672 Nonsense Mutation detected in F1 DNA During 2018
sa23525 Nonsense Available for shipment Available now
sa6145 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090081 Nonsense 211 831 6 14
ENSDART00000140732 Nonsense 181 801 5 13
Genomic Location (Zv9):
Chromosome 19 (position 24866076)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24796188
GRCz11 19 24380411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGTGAGGGCAGCCATGTTGATCTGAAACTGGATGATACACTTGGATG[G/A]TTAGAAGGCAAGGAAAAACTGCTGATGGTTTATACTGATTTACTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090081 Nonsense 310 831 8 14
ENSDART00000140732 Nonsense 280 801 7 13
Genomic Location (Zv9):
Chromosome 19 (position 24866772)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24796884
GRCz11 19 24381107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGCCTTTCTCCACCAGAGGGCGCATCTGAGGATGAAACACTCTTCTA[T/A]GGGATTTTCACTTCTCAGTGGTGAGGGAACTTGCTTCAGGTTTTTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090081 Nonsense 706 831 14 14
ENSDART00000140732 Nonsense 676 801 13 13
Genomic Location (Zv9):
Chromosome 19 (position 24874448)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24804560
GRCz11 19 24388783
KASP Assay ID:
554-3678.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGCAAAAACTTCACTCCCTTGATTAGTGCAGAAGAGGAAAGCTCCTG[G/A]ATGAATGAACGCAGTGGAAACTTCAAGCAAGTGGATAAACCAACCTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link