
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-69k21.4
- Ensembl ID:
- ENSDARG00000062347
- ZFIN ID:
- ZDB-GENE-091204-75
- Human Orthologue:
- MTUS2
- Human Description:
- microtubule associated tumor suppressor candidate 2 [Source:HGNC Symbol;Acc:20595]
- Mouse Orthologue:
- Mtus2
- Mouse Description:
- microtubule associated tumor suppressor candidate 2 Gene [Source:MGI Symbol;Acc:MGI:1915388]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11453 | Nonsense | Available for shipment | Available now |
sa9452 | Essential Splice Site | Available for shipment | Available now |
sa9606 | Essential Splice Site | Available for shipment | Available now |
sa34904 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa11453
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090059 | Nonsense | 282 | 1303 | 1 | 14 |
ENSDART00000141387 | None | 243 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 10 (position 24996076)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 24595428 GRCz11 10 24564880 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCATAAAAGTGCATAAATTCCCAATGGAAGCGGAGSARAATACTGGATA[T/A]AAATGGATGTCAACTGAGGTGCCRAAAGGTATGGTGAGGGTACAACCTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9452
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090059 | Essential Splice Site | 678 | 1303 | 2 | 14 |
ENSDART00000141387 | Essential Splice Site | 86 | 243 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 10 (position 24997400)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 24596752 GRCz11 10 24566204 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCAATGCAGGCAGTTAACCCAACCACTCAAACTCCTCAGGAAACACAAG[G/A]TAAGATCTATCGCACAGTTCCATTTATATGGCATGTTTTACATCGCTTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9606
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090059 | Essential Splice Site | 803 | 1303 | None | 14 |
ENSDART00000141387 | Essential Splice Site | 211 | 243 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 10 (position 25036548)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 24635900 GRCz11 10 24605352 - KASP Assay ID:
- 2260-3244.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCAGTTAATTCCCACACACTGCCATTAACTSTTGTCTTTCTTTCTCCGM[A/T]GTATCCCGTAAGGAATTCCAGAAGAGTTCGGATGGCTCCCGTTCATCCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34904
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000090059 | Nonsense | 1059 | 1303 | 10 | 14 |
ENSDART00000141387 | None | 243 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 10 (position 25048142)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 24647494 GRCz11 10 24616946 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGACAGAAATGGGGAGAAGAGCTCAATCTCATTTCGTTTATCTTAGATT[T/A]AAGGAAAGCCCATGAGCAGCAGAAAGCCAGTCTAGAAGAGGACTTCGAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Insomnia (caffeine-induced): A genome-wide association study of caffeine-related sleep disturbance: confirmation of a role for a common variant in the adenosine receptor. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: