cacna1r

Ensembl ID:
ENSDARG00000062346
ZFIN ID:
ZDB-GENE-081104-526
Description:
Novel protein similar to vertebrate calcium channel, voltage-dependent, R type, alpha 1E subunit (CA
Human Orthologue:
CACNA1E
Human Description:
calcium channel, voltage-dependent, R type, alpha 1E subunit [Source:HGNC Symbol;Acc:1392]
Mouse Orthologue:
Cacna1e
Mouse Description:
calcium channel, voltage-dependent, R type, alpha 1E subunit Gene [Source:MGI Symbol;Acc:MGI:106217]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9991 Nonsense Available for shipment Available now
sa34351 Nonsense Mutation detected in F1 DNA During 2018
sa31636 Essential Splice Site Available for shipment Available now
sa946 Essential Splice Site F2 line generated During 2018
sa34352 Essential Splice Site Mutation detected in F1 DNA During 2018
sa846 Essential Splice Site Available for shipment Available now
sa45313 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21228 Essential Splice Site Available for shipment Available now
sa38677 Nonsense Mutation detected in F1 DNA During 2018
sa16705 Nonsense Available for shipment Available now
sa21229 Nonsense Available for shipment Available now
sa31637 Nonsense Available for shipment Available now
sa17403 Nonsense Available for shipment Available now
sa41152 Essential Splice Site Mutation detected in F1 DNA During 2018
sa27153 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 452 2318 9 47
ENSDART00000132899 Nonsense 376 741 8 18
ENSDART00000139972   None 850 None 23
Genomic Location (Zv9):
Chromosome 8 (position 15290076)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14735420
GRCz11 8 14773125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCGAGAGCGGGTAGAGAACCGGAGAGCCTTCATGAARCTTAGGAGA[C/T]AGCAGCAGATTGAGAGGGAGCTGAACGGATATCGGGCCTGGATCKACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 706 2318 15 47
ENSDART00000132899 Nonsense 630 741 14 18
ENSDART00000139972   None 850 None 23
Genomic Location (Zv9):
Chromosome 8 (position 15296485)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14741829
GRCz11 8 14779534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTCTCTTTATTGTGGTCTTTGCACTTCTGGGCATGCAGCTCTTTGGT[G/T]GAAGGTAAGAGCTTATCAGTCTGAGTGCATACAATGCCTGTAGACATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 707 2318 15 47
ENSDART00000132899 Essential Splice Site 631 741 14 18
ENSDART00000139972   None 850 None 23
Genomic Location (Zv9):
Chromosome 8 (position 15296490)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14741834
GRCz11 8 14779539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTATTGTGGTCTTTGCACTTCTGGGCATGCAGCTCTTTGGTGGAAG[G/A]TAAGAGCTTATCAGTCTGAGTGCATACAATGCCTGTAGACATAGATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa946
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 1221 2318 23 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Essential Splice Site 63 850 3 23
Genomic Location (Zv9):
Chromosome 8 (position 15311599)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14756943
GRCz11 8 14794648
KASP Assay ID:
554-0851.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGAATATGATCCCATTTCATCTCTCTTATTCTCTGTTCTCCCCTACA[G/T]GGTCCGCAGGGCCTGCCACTACGTTGTCAACCTTCGTTATTTTGAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 1522 2318 30 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Essential Splice Site 364 850 10 23
Genomic Location (Zv9):
Chromosome 8 (position 15319922)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14765266
GRCz11 8 14802971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACAGGGTGACAAAATGATGGAGGAGTGTAGTCTGGAGAAAAACGAGG[T/A]GAATAAAAATGTTTGCTTGTACATTTTGAACTCTAGCTGAGTGCCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 1683 2318 34 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Essential Splice Site 525 850 14 23
Genomic Location (Zv9):
Chromosome 8 (position 15325029)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14770373
GRCz11 8 14808078
KASP Assay ID:
554-0749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTACACCATCCGTATTCTGCTCTGGACTTTTGTTCAGTCCTTCAAGG[T/G]CAGACATGTCTTGCGCTGCACTAGATTGAAATCCCTTATTCTTCTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 1736 2318 36 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Essential Splice Site 578 849 16 23
Genomic Location (Zv9):
Chromosome 8 (position 15326903)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14772247
GRCz11 8 14809952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACACAATAACTTCAGGACTTTCTTTGGTGCACTCATGCTTTTGTTCAG[G/A]TAAGATTATGGTAATGAATTCTGCATGCTTTAATGTCATTATTATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 1835 2318 38 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Essential Splice Site 677 850 18 23
Genomic Location (Zv9):
Chromosome 8 (position 15327524)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14772868
GRCz11 8 14810573
KASP Assay ID:
2260-0301.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAGATGAGTTTGTACGGATCTGGGGAGAGTATGACCGTGCTGCATGG[T/A]AAGAGATGCAGCTTTATACCCTTTCTGTTTATGATGCATAATAAAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 1902 2318 40 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Nonsense 744 850 20 23
Genomic Location (Zv9):
Chromosome 8 (position 15334620)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14779964
GRCz11 8 14817669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCACACTTATGGCCCTCATACGCACCGCACTGGACATTAAAATTGCT[C/T]GAGGTTGGCATCACTCATTTATTTCTTTGTCTATAAATAAAAAACACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 1913 2318 41 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Nonsense 755 850 21 23
Genomic Location (Zv9):
Chromosome 8 (position 15334730)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14780074
GRCz11 8 14817779
KASP Assay ID:
2260-0302.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGAKCATTGTTTAATAGGAGGGGAAGACAGGGGTCAGATGGATGTT[G/T]AACTGCAGAAGGAAATCAGTGTCATCTGGCCGCATCTCTCACAGAAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 1948 2318 42 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Nonsense 790 850 22 23
Genomic Location (Zv9):
Chromosome 8 (position 15335280)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14780624
GRCz11 8 14818329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAACAACTCTTTTTTCCAGCTAGTGACATGACCATTGGGAAGATCTA[T/A]GCAGCCATGATGATCATGGACTACTACAAGCAGAACAAAGCCAAGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 1961 2318 42 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Nonsense 803 850 22 23
Genomic Location (Zv9):
Chromosome 8 (position 15335317)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14780661
GRCz11 8 14818366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGAAGATCTATGCAGCCATGATGATCATGGACTACTACAAGCAGAAC[A/T]AAGCCAAGAAGCTCCGTCAGCAGCTCGAGGAACAGGTAGAGACATGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 1985 2318 43 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972 Nonsense 827 850 23 23
Genomic Location (Zv9):
Chromosome 8 (position 15335659)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14781003
GRCz11 8 14818708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGWCTTGCAGAAWCACGCACCAATGTTCCAACGCATGGATGCATCCT[C/A]GCTGCCGCAGGAMATCCTCTGCAGTGCCAAGGCTTTGCCATTCCTGACYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 2097 2318 45 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972   None 850 None 23
Genomic Location (Zv9):
Chromosome 8 (position 15342933)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14788277
GRCz11 8 14825982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTGAGTCCTGACCGGCTGGAGAGACCCAGGCAAAGAAGCTTCAGAGG[T/C]CAGTTTGCATTAAAGGATGCAGTTGGTACTAAAATTGAAAAGAAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 2114 2318 46 47
ENSDART00000132899   None 741 None 18
ENSDART00000139972   None 850 None 23
Genomic Location (Zv9):
Chromosome 8 (position 15343430)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14788774
GRCz11 8 14826479
KASP Assay ID:
2260-0305.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCAGGTCAAACCTGCGGGAGCCAGTGGACAAAGAGAGAGGACGGTCT[A/T]AAGAACGAAGACACCTGCTGTCTCCAGATGTGTCTCGCTGCAACTCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link