WFS1 (1 of 2)

Ensembl ID:
ENSDARG00000062341
Description:
Wolfram syndrome 1 (wolframin) [Source:HGNC Symbol;Acc:12762]
Human Orthologue:
WFS1
Human Description:
Wolfram syndrome 1 (wolframin) [Source:HGNC Symbol;Acc:12762]
Mouse Orthologue:
Wfs1
Mouse Description:
Wolfram syndrome 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1328355]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45069 Nonsense Mutation detected in F1 DNA During 2018
sa10021 Nonsense Available for shipment Available now
sa11465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090025 Nonsense 407 1061 7 9
Genomic Location (Zv9):
Chromosome 1 (position 13207747)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13636489
GRCz11 1 14323002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAAACAGGAAAAAAACGAAATGGCTCCTGTTACTCATAAGCGCCAA[C/T]GAAAGTCTAGCTGGGGAATGAGGAGCAGTGGGTTGATGCTGACTACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090025 Nonsense 692 1061 9 9
Genomic Location (Zv9):
Chromosome 1 (position 13199706)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13628448
GRCz11 1 14314961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGAGGGACGTACTGTTTCCTGGTGCCGTACTTGGTCTGCTTTGTCT[G/A]GTGYGAGTTCTCTGTGGTTCTGCTTCGGAACTCCACCACCATCGGCCTRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090025 Nonsense 825 1061 9 9
Genomic Location (Zv9):
Chromosome 1 (position 13199306)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13628048
GRCz11 1 14314561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAGGTTTATAACTCCACACTCACCTGGGAGGAATATGGCACACTGTG[C/A]GGCCCGCAAGCCTGGAAAGAACGAGGAATGGCTCAAACGCAGCTCTCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link