zeb2a

Ensembl ID:
ENSDARG00000062338
ZFIN ID:
ZDB-GENE-070912-553
Description:
zinc finger E-box-binding homeobox 2 isoform 1 [Source:RefSeq peptide;Acc:NP_001108023]
Human Orthologue:
ZEB2
Human Description:
zinc finger E-box binding homeobox 2 [Source:HGNC Symbol;Acc:14881]
Mouse Orthologue:
Zeb2
Mouse Description:
zinc finger E-box binding homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1344407]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34655 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16793 Essential Splice Site Available for shipment Available now
sa34656 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090028 Essential Splice Site 19 1196 2 10
ENSDART00000127834 Essential Splice Site 41 1218 2 10
ENSDART00000130059   None 370 None 3
ENSDART00000144499 Essential Splice Site 41 76 2 3
ENSDART00000146011 Essential Splice Site 41 204 1 5

The following transcripts of ENSDARG00000062338 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 26810688)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25966474
GRCz11 9 25777343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCCCCGGTGTAAGAGGAGAAAACAGGCCAATCCGAGGAGAAAGAACG[G/A]TAAGAAAGTGTCTCGTGTCGAAAAAACTTGTCTCCGGCTTGTTCTCGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090028 Essential Splice Site 92 1196 3 10
ENSDART00000127834 Essential Splice Site 114 1218 3 10
ENSDART00000130059   None 370 None 3
ENSDART00000144499   None 76 None 3
ENSDART00000146011 Essential Splice Site 114 204 2 5

The following transcripts of ENSDARG00000062338 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 26854673)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26010459
GRCz11 9 25821328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGGGGCAGGAGCCCATGTTTGGCGCCACGGGGAGCTGAATGGYTCAG[G/A]TAAGAGTTAGAAATGAGAATATCAGACTGAACTGTTGTATAAAGNNNTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090028 Essential Splice Site 1002 1196 9 10
ENSDART00000127834 Essential Splice Site 1024 1218 9 10
ENSDART00000130059   None 370 None 3
ENSDART00000144499   None 76 None 3
ENSDART00000146011   None 204 None 5

The following transcripts of ENSDARG00000062338 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 26866765)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 26022551
GRCz11 9 25833420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTCCAGAAGACCAGTTCCCTCCTAAGACACAAATATGAGCACACAGG[T/C]ATATCACATTTAGACAACTCTTTTTTTTTTACCCTCGTCCATCCCCCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link