wu:fj40f01

Ensembl ID:
ENSDARG00000062323
Human Orthologue:
ADAM23
Human Description:
ADAM metallopeptidase domain 23 [Source:HGNC Symbol;Acc:202]
Mouse Orthologue:
Adam23
Mouse Description:
a disintegrin and metallopeptidase domain 23 Gene [Source:MGI Symbol;Acc:MGI:1345162]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9934 Nonsense Available for shipment Available now
sa20667 Nonsense Available for shipment Available now
sa17371 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089934 Nonsense 68 774 2 27
Genomic Location (Zv9):
Chromosome 6 (position 13095998)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12952488
GRCz11 6 13186023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACKATTCGACCGAAGRCAAAACAGGAGAGCACCCTGTCACCATCACATA[T/A]CCCTCCCGGCTCATCTACTACCTGAACGAGGAGTCGGAGAGCACCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089934 Nonsense 137 774 4 27
Genomic Location (Zv9):
Chromosome 6 (position 13081026)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12937516
GRCz11 6 13171051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTTTTATTTCAGTGATCTACTGTCTTCAGATTACATCGAGATCCACTA[T/A]GAGAACGACAAGCCAGTTCTATCCAGGGTAAGACACAGAGAGCAGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089934 Nonsense 206 774 7 27
Genomic Location (Zv9):
Chromosome 6 (position 13075863)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12932353
GRCz11 6 13165888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWATACTCTTTRTATTTTAGGAGACAGAGGCGCGGCCTCACACWTTACGA[C/T]GAACRTCATCTCTCGGTYTGACCWCTATCCCAGATGACTGGAGTAAGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link