zgc:153153

Ensembl ID:
ENSDARG00000062307
ZFIN ID:
ZDB-GENE-060929-348
Description:
Coiled-coil domain-containing protein 61 [Source:UniProtKB/Swiss-Prot;Acc:Q08CF3]
Human Orthologue:
CCDC61
Human Description:
coiled-coil domain containing 61 [Source:HGNC Symbol;Acc:33629]
Mouse Orthologue:
Ccdc61
Mouse Description:
coiled-coil domain containing 61 Gene [Source:MGI Symbol;Acc:MGI:2685005]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43627 Nonsense Mutation detected in F1 DNA During 2018
sa23916 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089651 Nonsense 89 511 4 13
ENSDART00000108978 Nonsense 89 525 4 14
Genomic Location (Zv9):
Chromosome 21 (position 20094463)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21229952
GRCz11 21 21266588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGTATTTTACAGTCCAGCGACTCCGTGACCCTTGACCTTTTGACGTA[T/A]TCTGACCTCGAGCTTCTGCGAAACAGAAAGGCAGGTGTCGTCGGCCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089651 Splice Site, Nonsense 249 511 6 13
ENSDART00000108978 Splice Site, Nonsense 249 525 6 14
Genomic Location (Zv9):
Chromosome 21 (position 20097239)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21232728
GRCz11 21 21269364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGCGGTCTGCAATCAAGAAGAGCCAGGAACAGCGCCTCCTGGTGGAA[C/T]AGGTCAGTGTACACATTACATTGGTACAGTTATGAGATAGACAAACTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link