znf652

Ensembl ID:
ENSDARG00000062302
ZFIN ID:
ZDB-GENE-030131-5857
Human Orthologue:
ZNF652
Human Description:
zinc finger protein 652 [Source:HGNC Symbol;Acc:29147]
Mouse Orthologue:
Zfp652
Mouse Description:
zinc finger protein 652 Gene [Source:MGI Symbol;Acc:MGI:2442221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19968 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089923 Essential Splice Site 149 617 2 7
ENSDART00000146651   None 247 None 6
Genomic Location (Zv9):
Chromosome 3 (position 15381040)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15626641
GRCz11 3 15776441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAGGAGGATGAAGATGAGGATGATGAGGAGGAGGAGGAGGAAGAGGA[C/A]AGTGTTGAAGAGAACTACAGTGATCTGGATGAAGATGAAGAAGAGGAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Prostate cancer: Genome-wide association study of prostate cancer in men of African ancestry identifies a susceptibility locus at 17q21. (View Study)
  • Sex hormone-binding globulin levels: A genome-wide association meta-analysis of circulating sex hormone-binding globulin reveals multiple Loci implicated in sex steroid hormone regulation. (View Study)
  • Systolic blood pressure: Genome-wide association study identifies eight loci associated with blood pressure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link