slc25a15b

Ensembl ID:
ENSDARG00000062271
ZFIN ID:
ZDB-GENE-060526-35
Description:
hypothetical protein LOC565335 [Source:RefSeq peptide;Acc:NP_001121816]
Human Orthologues:
SLC25A15, SLC25A2
Human Descriptions:
solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 [Source:HGNC Symbo
solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2 [Source:HGNC Symbol
Mouse Orthologues:
Slc25a15, Slc25a2
Mouse Descriptions:
solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15 Gene [Source:MGI S
solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 2 Gene [Source:MGI Sy

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45199 Nonsense Mutation detected in F1 DNA During 2018
sa18799 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089851 Nonsense 236 302 5 6
ENSDART00000136570 Nonsense 241 307 5 6
Genomic Location (Zv9):
Chromosome 5 (position 25830881)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23658146
GRCz11 5 24161946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTGGTGGAGCTTGTCTCTGGCTGGTGGTTTACCCAATGGACTGTGTT[A/T]AATCCAGGATACAGGTCATGTCGATGACAGGCAGACAATCAGGCTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089851 Essential Splice Site 263 302 5 6
ENSDART00000136570 Essential Splice Site 268 307 5 6
Genomic Location (Zv9):
Chromosome 5 (position 25830964)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23658229
GRCz11 5 24162029
KASP Assay ID:
2259-5766.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAATCAGGCTTCTTCAAGACTTTCATGCATATCTTCAGAACCGAAGG[T/A]AAGACAAAGATCTGAGCATTGATATTATGATTTACCCAATAACAATTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link