zgc:85942

Ensembl ID:
ENSDARG00000062262
ZFIN ID:
ZDB-GENE-040426-2364
Description:
hypothetical protein LOC405866 [Source:RefSeq peptide;Acc:NP_998095]
Human Orthologue:
EDNRA
Human Description:
endothelin receptor type A [Source:HGNC Symbol;Acc:3179]
Mouse Orthologue:
Ednra
Mouse Description:
endothelin receptor type A Gene [Source:MGI Symbol;Acc:MGI:105923]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44063 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16023 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089837 Essential Splice Site 208 328 None 6
ENSDART00000089841 Essential Splice Site 278 363 None 8
ENSDART00000111996 Essential Splice Site 278 363 None 8
Genomic Location (Zv9):
Chromosome 23 (position 46049720)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45964546
GRCz11 23 45699741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTGTGTGTTTTTTATATAAATGTGTGTGTGTGTGTGTGTGTGTGTGT[A/G]GAGGCGGGAGGTGGCCAAAGCCGTGTTCTCTCTGGTGCTGATCTTCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089837 Essential Splice Site 289 328 None 6
ENSDART00000089841 Essential Splice Site 311 363 None 8
ENSDART00000111996 Essential Splice Site 311 363 None 8
Genomic Location (Zv9):
Chromosome 23 (position 46054903)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45959363
GRCz11 23 45694558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTGTGTGTGNNTCATCTCATGTGTGTGTGGTCTCTCCTC[A/T]GTCGTGTCTGTGCTGCTGGTGTTACTCAGACRGGTCTCTGATGGGCAGYG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Carotid intima media thickness: Meta-analysis of genome-wide association studies from the CHARGE consortium identifies common variants associated with carotid intima media thickness and plaque. (View Study)
  • Dental caries: GWAS of dental caries patterns in the permanent dentition. (View Study)
  • Intracranial aneurysm: Genome-wide association study for intracranial aneurysm in the Japanese population identifies three candidate susceptible loci and a functional genetic variant at EDNRA. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link