TNK2 (2 of 3)

Ensembl ID:
ENSDARG00000062261
Description:
tyrosine kinase, non-receptor, 2 [Source:HGNC Symbol;Acc:19297]
Human Orthologue:
TNK2
Human Description:
tyrosine kinase, non-receptor, 2 [Source:HGNC Symbol;Acc:19297]
Mouse Orthologue:
Tnk2
Mouse Description:
tyrosine kinase, non-receptor, 2 Gene [Source:MGI Symbol;Acc:MGI:1858308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44151 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089788 Splice Site, Nonsense 79 1007 3 16
Genomic Location (Zv9):
Chromosome 24 (position 26455799)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25896157
GRCz11 24 26041198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGCAGGTGGAATCACCCTCAGCCGTAGTCTCTGTGTTTGGGTCAG[C/T]AGGTGTTTACCGGGAAGCGCCCTGACTCCGATTCGCAGACTCCAGAGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link