zgc:153683

Ensembl ID:
ENSDARG00000062258
ZFIN ID:
ZDB-GENE-061027-88
Description:
Armadillo repeat-containing protein 8 [Source:UniProtKB/Swiss-Prot;Acc:Q05AL1]
Human Orthologue:
ARMC8
Human Description:
armadillo repeat containing 8 [Source:HGNC Symbol;Acc:24999]
Mouse Orthologue:
Armc8
Mouse Description:
armadillo repeat containing 8 Gene [Source:MGI Symbol;Acc:MGI:1921375]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21497 Essential Splice Site Available for shipment Available now
sa41433 Nonsense Mutation detected in F1 DNA During 2018
sa21498 Essential Splice Site Available for shipment Available now
sa9128 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31717 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089761 Essential Splice Site 112 673 4 22
ENSDART00000133997 Essential Splice Site 113 674 4 22
Genomic Location (Zv9):
Chromosome 9 (position 28917660)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28073356
GRCz11 9 27884102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATCAAGTCCCTGGTGGACTGTCACATCATCCCAGCCCTGCTGCAAG[G/A]TTCTCAATCTATTATTTTTTCTTGAAATCTATGGACATTTCTACTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089761 Nonsense 175 673 6 22
ENSDART00000133997 Nonsense 176 674 6 22
Genomic Location (Zv9):
Chromosome 9 (position 28918019)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28073715
GRCz11 9 27884461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCACAGCACACGCAGGAATACATCACGCAAATCTTCGCCCACTGCTG[C/A]AAGGTAGTTTAGTTTAAACCTTTATTATTCCCTTTGGGGCAATTCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089761 Essential Splice Site 279 673 10 22
ENSDART00000133997 Essential Splice Site 280 674 10 22
Genomic Location (Zv9):
Chromosome 9 (position 28922024)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28077720
GRCz11 9 27888466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCGAGCAGGAGCCATCAGGACAGAAGACAACTGCATTGTACTGAAGG[T/C]AGCAACAACACCTATTCATATTGTGACTAATTTAAAAGCTGACAGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089761 Essential Splice Site 433 673 14 22
ENSDART00000133997 Essential Splice Site 434 674 14 22
Genomic Location (Zv9):
Chromosome 9 (position 28925166)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28080862
GRCz11 9 27891608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAGAACGAGTTTCCATGATCATGCCGTATGGAAACCACTAATGAAGG[T/G]ATGACATCTCRATGATGCTAAGCTRAATATCAAMGCTAATCTAAGCTRAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089761 Essential Splice Site 663 673 21 22
ENSDART00000133997 Essential Splice Site 664 674 21 22
Genomic Location (Zv9):
Chromosome 9 (position 28933497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTCTACACAAACTTACCCAGGCATCAGATCCCAACCTCTGTGACAGG[T/G]GAAGGACACACACACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link