skiv2l

Ensembl ID:
ENSDARG00000062206
ZFIN ID:
ZDB-GENE-010430-5
Description:
helicase SKI2W [Source:RefSeq peptide;Acc:NP_001038366]
Human Orthologue:
SKIV2L
Human Description:
superkiller viralicidic activity 2-like (S. cerevisiae) [Source:HGNC Symbol;Acc:10898]
Mouse Orthologue:
Skiv2l
Mouse Description:
superkiller viralicidic activity 2-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1099835]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14407 Nonsense Available for shipment Available now
sa14666 Nonsense Available for shipment Available now
sa43295 Nonsense Mutation detected in F1 DNA During 2018
sa36849 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43294 Nonsense Mutation detected in F1 DNA During 2018
sa44917 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14992 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089609 Nonsense 153 1249 5 29
ENSDART00000135607 Nonsense 153 743 5 19
ENSDART00000136216   None 114 None 2

The following transcripts of ENSDARG00000062206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27404875)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27334987
GRCz11 19 26919210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATTCAYTCTCGTTACAAAGACAGCCTGGACCTCCGTCAGAGAGTCTG[C/T]GAGGGAGCAACACAAACTAYCCATTTCTGCCAGGTACAGYACTTTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089609 Nonsense 569 1249 16 29
ENSDART00000135607 Nonsense 569 743 16 19
ENSDART00000136216   None 114 None 2

The following transcripts of ENSDARG00000062206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27396641)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27326753
GRCz11 19 26910976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTTCTGCACTGTTAGGATCGTGCGGTGTGGCARACRCTGTTAAATTA[T/A]CTGTCTCAGAGGCAGCAGACTCCAGTGGTGGCRTTYACRTTCTCTAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089609 Nonsense 587 1249 16 29
ENSDART00000135607 Nonsense 587 743 16 19
ENSDART00000136216   None 114 None 2

The following transcripts of ENSDARG00000062206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27396589)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27326701
GRCz11 19 26910924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCAGAGGCAGCAGACTCCAGTGGTGGCATTTACATTCTCTAGGACA[C/T]GATGTGATGAAAACGCTCGCTCTTTGACCTCTCTGGACCTCACCACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089609 Essential Splice Site 666 1249 17 29
ENSDART00000135607 Essential Splice Site 666 743 17 19
ENSDART00000136216   None 114 None 2

The following transcripts of ENSDARG00000062206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27393532)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27323644
GRCz11 19 26907867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCCTGAAGGAAGTCATTGAAATGCTCTTCTCCAGAGGTTTAGTGAAG[G/A]TTTGTCTTTTGAATTTCTATGGTAATCTATATCTGGTCTTTATCTGGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089609 Nonsense 791 1249 21 29
ENSDART00000135607   None 743 None 19
ENSDART00000136216   None 114 None 2

The following transcripts of ENSDARG00000062206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27380797)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27310909
GRCz11 19 26895132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCTTTCAGTTAGCCAGGTTATTTCTGTTGTTTTTGTAGGCTCACGAG[A/T]AGAGAATAAGTGAGCTGAGAAACACGCTGTCTTCTCTTCCTCCGCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089609 Essential Splice Site 833 1249 21 29
ENSDART00000135607   None 743 None 19
ENSDART00000136216   None 114 None 2

The following transcripts of ENSDARG00000062206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27380667)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27310779
GRCz11 19 26895002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTACCACACAATCACAGAGCTGCACATCACCACACAGAGCCTGCAGG[T/C]ACCCACTCACAAACACACTCACACACGCTTTGATGCACACAGTGTGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089609 Nonsense 1155 1249 28 29
ENSDART00000135607   None 743 None 19
ENSDART00000136216 Nonsense 20 114 1 2

The following transcripts of ENSDARG00000062206 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 27360884)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27290996
GRCz11 19 26875219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAAGTTCTCGCTGTAGCCCAGCGTATCGGTGACCTGCAGAGGGATTG[T/A]GGGATTGCTCAGACCRCTGAAGACTTCGTGGCCCAGTTCAAGTTTGGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link