
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
FBXO31
- Ensembl ID:
- ENSDARG00000062195
- Description:
- F-box protein 31 [Source:HGNC Symbol;Acc:16510]
- Human Orthologue:
- FBXO31
- Human Description:
- F-box protein 31 [Source:HGNC Symbol;Acc:16510]
- Mouse Orthologue:
- Fbxo31
- Mouse Description:
- F-box protein 31 Gene [Source:MGI Symbol;Acc:MGI:1354708]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45853 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa1009 | Essential Splice Site | Available for shipment | Available now |
sa11947 | Essential Splice Site | Available for shipment | Available now |
sa19363 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45853
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089642 | Essential Splice Site | 190 | 542 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 25 (position 22548063)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21779939 GRCz11 25 21877487 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTCTGGCAGCCTGATATCGGGCCCTATGGAGGACTGCTGAATGTGGTG[G/A]TAAGATCACAAAACAATAACACAATTTAATTAGAATTTAAATACAAGACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1009
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089642 | Essential Splice Site | 190 | 542 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 25 (position 22548062)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21779938 GRCz11 25 21877486 - KASP Assay ID:
- 554-0913.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTCTGGCAGCCTGATATCGGGCCCTATGGAGGACTGCTGAATGTGGTGG[T/G]AAGATCACAAAACAATAACACAATTTAATTAGAATTTAAATRCAAGACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11947
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089642 | Essential Splice Site | 271 | 542 | 5 | 9 |
ENSDART00000089642 | Essential Splice Site | 271 | 542 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 25 (position 22537095)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21768971 GRCz11 25 21866519 - KASP Assay ID:
- 554-6230.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAAGTGCAACCAGACCGATCACCATCGAATGCCTGGAGGAAGGCAAGAGG[T/G]AAGAGAGCAGYGATGCYTGCACAGATTTTAANGGAATACTATGGCAGAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19363
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089642 | Essential Splice Site | 271 | 542 | 5 | 9 |
ENSDART00000089642 | Essential Splice Site | 271 | 542 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 25 (position 22537095)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21768971 GRCz11 25 21866519 - KASP Assay ID:
- 554-6230.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAGTGCAACCAGACCGATCACCATCGAATGCCTGGAGGAAGGCAAGAGG[T/G]AAGAGAGCAGTGATGCTTGCACAGATTTTAAGGAATACTATGGCAGAATT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: A mega-analysis of genome-wide association studies for major depressive disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: