kif14

Ensembl ID:
ENSDARG00000062187
ZFIN ID:
ZDB-GENE-030131-5759
Description:
kinesin-like protein KIF14 [Source:RefSeq peptide;Acc:NP_001038441]
Human Orthologue:
KIF14
Human Description:
kinesin family member 14 [Source:HGNC Symbol;Acc:19181]
Mouse Orthologue:
Kif14
Mouse Description:
kinesin family member 14 Gene [Source:MGI Symbol;Acc:MGI:1098226]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43838 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24165 Nonsense Available for shipment Available now
sa31072 Nonsense Mutation detected in F1 DNA During 2018
sa43839 Nonsense Mutation detected in F1 DNA During 2018
sa43840 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089622 Essential Splice Site 498 1506 8 29
ENSDART00000147825 Essential Splice Site 301 1307 8 29
Genomic Location (Zv9):
Chromosome 22 (position 22807412)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22419048
GRCz11 22 22444026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAGTGAGCGCTGTACTTCAGCCCAGACCAGCGGAGACCGGCTCAGGG[T/C]AATCCAGCATCCAAAAGCTCTGTTTATTCAATCTGAAGATTACTTTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089622 Nonsense 624 1506 11 29
ENSDART00000147825 Nonsense 427 1307 11 29
Genomic Location (Zv9):
Chromosome 22 (position 22811152)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22422788
GRCz11 22 22447766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGATGAGCTCTCAGGGAGTCGAGCCGGAGAAGATGAGACTCTTTCAG[C/T]AAGAGATTGCAGCGCTCAAGAACAAACTCTGCCAACAGGAGCATGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089622 Nonsense 700 1506 13 29
ENSDART00000147825 Nonsense 503 1307 13 29
ENSDART00000089622 Nonsense 700 1506 13 29
ENSDART00000147825 Nonsense 503 1307 13 29
Genomic Location (Zv9):
Chromosome 22 (position 22816532)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22428168
GRCz11 22 22453146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAATGAGGATCCGCAGCTGTCAGAGATGCTGCTGTACATGATTAAA[G/T]AGGGCCAAACCAAGGTCGGCAAGCTCAAGTCTGAGTCGGCACACGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089622 Nonsense 700 1506 13 29
ENSDART00000147825 Nonsense 503 1307 13 29
ENSDART00000089622 Nonsense 700 1506 13 29
ENSDART00000147825 Nonsense 503 1307 13 29
Genomic Location (Zv9):
Chromosome 22 (position 22816532)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22428168
GRCz11 22 22453146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAATGAGGATCCGCAGCTGTCAGAGATGCTGCTGTACATGATTAAA[G/T]AGGGCCAAACCAAGGTCGGCAAGCTCAAGTCTGAGTCGGCACACGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089622 Nonsense 933 1506 18 29
ENSDART00000147825 Nonsense 736 1307 18 29
Genomic Location (Zv9):
Chromosome 22 (position 22822980)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22434616
GRCz11 22 22459594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGATCATGATGTCCGGCATGCTAAAATTGTAGCAGCTCTTGAGGCC[G/T]AAAAGAGGAAGATTGCCGAAGATTTGGCTCAGATTGAAATGAAACGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link