si:dkey-259n11.1

Ensembl ID:
ENSDARG00000062164
ZFIN ID:
ZDB-GENE-090312-21
Description:
si:dkey-259n11.1 [Source:RefSeq peptide;Acc:NP_001139087]
Human Orthologue:
ATRN
Human Description:
attractin [Source:HGNC Symbol;Acc:885]
Mouse Orthologue:
Atrn
Mouse Description:
attractin Gene [Source:MGI Symbol;Acc:MGI:1341628]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22249 Nonsense Available for shipment Available now
sa11715 Nonsense Available for shipment Available now
sa18455 Essential Splice Site Available for shipment Available now
sa19056 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14575 Nonsense Available for shipment Available now
sa10673 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089528 Nonsense 431 1383 8 29
ENSDART00000131875 Nonsense 431 1345 8 29
Genomic Location (Zv9):
Chromosome 13 (position 13932014)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13940009
GRCz11 13 14071001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGTGTTCGGGCACTGCCCTCTTTATGGATACATCAGCCAAGTGCAG[C/T]AGTACAATATAGGTCAGTAACACACAGTCTTCGCAGTAGGGTTGGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089528 Nonsense 459 1383 9 29
ENSDART00000131875 Nonsense 459 1345 9 29
Genomic Location (Zv9):
Chromosome 13 (position 13939690)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13947685
GRCz11 13 14078677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACTCGTGGAGCACTGGTTCAAGGTGGCTATGGGCACAGCAGTGTTTA[C/A]GACCCTCAGACCCRCTCCATCTACATCCATGGAGRCTACAAAGCCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089528 Essential Splice Site 737 1383 14 29
ENSDART00000131875 Essential Splice Site 737 1345 14 29
Genomic Location (Zv9):
Chromosome 13 (position 13953625)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13961620
GRCz11 13 14092612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAACTGCCARTGGGAGACCAGGAATCAAGAGTGCACCACCCTGCCTGG[T/A]AACAAACGCGAWCAAACTTTYGCTGGAATKTGTGTAAATGATTGAAGCAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089528 Essential Splice Site 933 1383 17 29
ENSDART00000131875 Essential Splice Site 933 1345 17 29
Genomic Location (Zv9):
Chromosome 13 (position 13959187)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13967182
GRCz11 13 14098174
KASP Assay ID:
2260-6179.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCCTATGGCCAGTGCATGGAGTGGTACACTATGAACAGCTGCCCACG[T/C]ACGTATGCCGGCGAAATGATTTTAAATCAAAGTATTATCTGTAATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089528 Nonsense 1243 1383 26 29
ENSDART00000131875 Nonsense 1243 1345 26 29
Genomic Location (Zv9):
Chromosome 13 (position 13998044)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14006039
GRCz11 13 14137031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCAGATTTGTTGAGTATCTCCTGTTTTGTTTTTGTTTTGTGCAGCTG[T/A]TTCCTGTCTTTGCTTCTGGTGGCAGCAGTYGTATGGAAGATCAAGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089528 Nonsense 1334 1383 28 29
ENSDART00000131875 Nonsense 1334 1345 28 29
Genomic Location (Zv9):
Chromosome 13 (position 14040416)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14048411
GRCz11 13 14179403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAKAAAGCAGCAGTGCTCTCCATCTTTGTTCGGTTACCCAGAGGCCCC[G/T]GAGGTATTCCTCCTCCAGGAYAGTCAGGTGGGTCTACAATCCAATGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link