sytl5

Ensembl ID:
ENSDARG00000062135
ZFIN ID:
ZDB-GENE-070912-424
Human Orthologue:
SYTL5
Human Description:
synaptotagmin-like 5 [Source:HGNC Symbol;Acc:15589]
Mouse Orthologue:
Sytl5
Mouse Description:
synaptotagmin-like 5 Gene [Source:MGI Symbol;Acc:MGI:2668451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45361 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18597 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089488 Essential Splice Site 351 745 9 19
ENSDART00000131683   None 369 None 8
ENSDART00000147030   None 149 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31373292)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30529238
GRCz11 9 30339984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTTCACAGTTTTTTTCCTCCGGTGTACAGGATATGGCTTCCGAACAG[G/A]GAGTTAAAATGATAAGAGACAGCCTGCTATAATGTGATTTTTCTGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089488 Nonsense 541 745 15 19
ENSDART00000131683 Nonsense 164 369 4 8
ENSDART00000147030   None 149 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31363695)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30519641
GRCz11 9 30330387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAGCTCACCTTTGACTCCTGGGAGTTTGAYACGCAGATAGAAGAATG[G/A]TTTGCTCTGCAGCCTAGAGTGAGTATAGCWCACGCACACATATAGACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link