zgc:171453

Ensembl ID:
ENSDARG00000062134
ZFIN ID:
ZDB-GENE-080219-36
Description:
hypothetical protein LOC565014 [Source:RefSeq peptide;Acc:NP_001104651]
Human Orthologue:
KCNAB2
Human Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 2 [Source:HGNC Symbol;Acc:622
Mouse Orthologue:
Kcnab2
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 2 Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24307 Nonsense Available for shipment Available now
sa37682 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086117 Nonsense 178 289 8 15
ENSDART00000125074 Nonsense 221 440 9 15
ENSDART00000132066 Nonsense 178 412 8 15
Genomic Location (Zv9):
Chromosome 23 (position 21394337)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21173644
GRCz11 23 21100195
KASP Assay ID:
2261-7611.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTGCATTTTTTTGACCTACAGGTCTAAGGGCATCACTGGAGAGACTT[C/T]AGTTAGAATATGTGGATGTAGTGTTTGCTAACAGACCTGACCCCAACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086117 Nonsense 204 289 9 15
ENSDART00000125074   None 440 None 15
ENSDART00000132066 Nonsense 204 412 9 15
Genomic Location (Zv9):
Chromosome 23 (position 21397627)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21176934
GRCz11 23 21103485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGTCTTTTGTTTGTTTGTTTATCACCAGGAGATCCATTTAACACTT[C/A]AAAATCAAGAACATTCATCATAGAAGGTACATGGTACCCTCAGTGAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link