zgc:153296

Ensembl ID:
ENSDARG00000062085
ZFIN ID:
ZDB-GENE-060929-652
Description:
bifunctional ATP-dependent dihydroxyacetone kinase/FAD-AMP lyase (cyclizing) [Source:RefSeq peptide
Human Orthologue:
DAK
Human Description:
dihydroxyacetone kinase 2 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24552]
Mouse Orthologue:
Dak
Mouse Description:
dihydroxyacetone kinase 2 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2385084]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40861 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089333 Essential Splice Site 259 576 7 16
Genomic Location (Zv9):
Chromosome 7 (position 20903338)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19493774
GRCz11 7 19745742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCACATGACTGATTCCTCAAACAAGTCACATCTGTCCCTGAAGTCAG[G/A]TAAGATGCTCTAATGCTCAAATTCTGATTGTGTATATCTATATGAACTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link