wdr85

Ensembl ID:
ENSDARG00000062083
ZFIN ID:
ZDB-GENE-070410-57
Description:
WD repeat-containing protein 85 [Source:RefSeq peptide;Acc:NP_001076308]
Human Orthologue:
WDR85
Human Description:
WD repeat domain 85 [Source:HGNC Symbol;Acc:25199]
Mouse Orthologue:
Wdr85
Mouse Description:
WD repeat domain 85 Gene [Source:MGI Symbol;Acc:MGI:1914478]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20414 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089339 Essential Splice Site 94 443 None 9

The following transcripts of ENSDARG00000062083 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26752601)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24579866
GRCz11 5 25083666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGGAGAGTCAGAGAATAGACACAGCAGCTATACTCGATCTCAAGTGG[T/C]GAGTCTATTAATAGGGTAAAGATGTTAAGAAGTAATTATCACGATCACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link