si:dkey-261h15.1

Ensembl ID:
ENSDARG00000062082
ZFIN ID:
ZDB-GENE-030131-82
Description:
homeodomain interacting protein kinase 3-like [Source:RefSeq peptide;Acc:NP_001073628]
Human Orthologue:
HIPK3
Human Description:
homeodomain interacting protein kinase 3 [Source:HGNC Symbol;Acc:4915]
Mouse Orthologue:
Hipk3
Mouse Description:
homeodomain interacting protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1314882]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43123 Nonsense Mutation detected in F1 DNA During 2018
sa10340 Nonsense Available for shipment Available now
sa23319 Essential Splice Site Available for shipment Available now
sa14412 Essential Splice Site Available for shipment Available now
sa6524 Nonsense Mutation detected in F1 DNA During 2018
sa45642 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089303 Nonsense 88 1261 1 16
ENSDART00000124046 Nonsense 88 341 2 2
ENSDART00000126500 Nonsense 88 348 1 2
ENSDART00000142336 Nonsense 88 1261 2 16
Genomic Location (Zv9):
Chromosome 18 (position 27876008)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27948860
GRCz11 18 27927100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACCGCGGGCAGGATTTCCCACTGCAGACGGCTGCTGTACAAGGTGTG[C/T]GACGTCAACACACCATCACAGTGGCACAGCAGCAAAAAAGAGGCGCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089303 Nonsense 294 1261 1 16
ENSDART00000124046 Nonsense 294 341 2 2
ENSDART00000126500 Nonsense 294 348 1 2
ENSDART00000142336 Nonsense 294 1261 2 16
Genomic Location (Zv9):
Chromosome 18 (position 27876626)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27949478
GRCz11 18 27927718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGGCAGTGAAGATCCTGAAGAATCATCCATCATATGCACGGCAGGGG[C/T]AGATTGAGGTGGGCATCCTGGCCCGCCTGAGCAATGAGAATGCCGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089303   344 1261 1 16
ENSDART00000124046   None 341 None 2
ENSDART00000126500 Essential Splice Site 344 348 None 2
ENSDART00000142336   344 1261 2 16
Genomic Location (Zv9):
Chromosome 18 (position 27876778)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27949630
GRCz11 18 27927870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGTGTTTGAGATGCTGGAGCAGAACTTGTATGACTTCCTCAAGCAAAA[T/C]AAATTCAGCCCATTACCTCTGAAGGTGATTCGTCCCATTCTTCAGCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089303 Essential Splice Site 532 1261 5 16
ENSDART00000124046   None 341 None 2
ENSDART00000126500   None 348 None 2
ENSDART00000142336 Essential Splice Site 532 1261 6 16
Genomic Location (Zv9):
Chromosome 18 (position 27919029)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27991881
GRCz11 18 27970121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATTGGAGGMCTCCATATGAATAATTAAAGTAGCTTATTTCTGTTTTC[A/T]GGTGAAWCTAGTGATGAATCTGGAAKGCTGTGATTTGTTGGCAGAGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089303 Nonsense 671 1261 7 16
ENSDART00000124046   None 341 None 2
ENSDART00000126500   None 348 None 2
ENSDART00000142336 Nonsense 671 1261 8 16
Genomic Location (Zv9):
Chromosome 18 (position 27930004)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28002856
GRCz11 18 27981096
KASP Assay ID:
554-4855.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAGTGATGCATCCTGGAATACCTCTTCAGACAGGAAGTGCTCAGTTT[G/T]GAGACTCTTTCCAGCAGGCGCTAATTCTCWGTCCCCCAACMATACAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089303 Essential Splice Site None 1261 15 16
ENSDART00000124046   None 341 None 2
ENSDART00000126500   None 348 None 2
ENSDART00000142336   None 1261 None 16
Genomic Location (Zv9):
Chromosome 18 (position 27942710)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28015562
GRCz11 18 27993802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTGCACGGTTGAGAATCAAGCGAATTGGATAAAAAAAAAAAAACTGT[T/C]TTGCACATTTGATACATCACCTTATCGGATTTTCAGATCTCTAGATTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link